Method for producing fructooligosaccharides by fermenting inulase mutants

A technology of fructooligosaccharide and inulinase, which is applied in the field of fermentation engineering, can solve problems such as complex process, high production cost, and incomplete reaction, and achieve the effects of reducing operation difficulty, saving economic cost, and reducing production cost

Active Publication Date: 2015-12-23
福建福大百特生物科技有限公司
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Enzymatic conversion of sucrose industrial large-scale synthesis of fructo-oligosaccharides, the by-product of the reaction glucose is an enzyme inhibitor, the reaction is not complete, the mixture contains a large amount of glucose and sucrose, the total amount of fructo-oligosaccharides is ≤55% to 60% % (dry basis), and the process is complicated and the production cost is high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing fructooligosaccharides by fermenting inulase mutants
  • Method for producing fructooligosaccharides by fermenting inulase mutants
  • Method for producing fructooligosaccharides by fermenting inulase mutants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Embodiment 1: Cloning and codon optimization of inuI gene

[0031] Construction of recombinant plasmid: Total RNA of Aspergillus niger NRRL3135 was extracted with TRNzol total RNA extraction reagent. Using total RNA as a template, referring to the instructions of the RT-PCR kit, using oligo(dT) as a primer to synthesize the first-strand cDNA by reverse transcription, and then respectively using the first-strand cDNA as a template, primers F1 (SEQ ID NO: 6) and R1 ( SEQ ID NO: 7) PCR amplifies the Aspergillus niger inulinase gene inuI. The PCR product and plasmid pPIC9K were digested with EcoRI and NotI, purified, ligated, and transformed into EscherichiacoliJM109 competent cells. Positive transformants were screened, and their plasmids were extracted for enzyme digestion verification. The correct recombinant plasmid verified by enzyme digestion was then sequenced (sequence SEQ ID NO: 1), and the correct recombinant plasmid constructed was named pPIC9K-inuI.

[0032] ...

Embodiment 2

[0033] Example 2: Construction of Aspergillus niger inulinase mutation library using error-prone PCR method

[0034] The nucleotide mutation ( figure 1 ). The reaction conditions for error-prone PCR are as follows:

[0035]

[0036] Wherein, primers F2 (SEQIDNO:8) and R2 (SEQIDNO:9) sequences (5'-3') are respectively:

[0037] Upstream primer F2: CCG GAATTC CAGTCTAATGATTACCGTCCTTCATAC

[0038] Downstream primer R2: ATAAGAAT GCGGCCGC TCATTCAAGTGAAACACTCCGC

[0039]PCR amplification conditions: 94°C for 3 min; 30 cycles of 94°C for 1 min, 58°C for 1 min, and 72°C for 1.5 min; 72°C for 10 min.

[0040] After the error-prone PCR amplification product is purified by DNA purification and recovery kit, it is digested with restriction endonucleases EcoRI and NotI, connected with the corresponding digested plasmid pPIC9K, and transformed into E.coliJM109 competent cells , spread on LB solid medium plate containing 100 μg / mL ampicillin. After culturing at 37°C and 200 rpm f...

Embodiment 3

[0043] Example 3: Screening of High Enzyme Activity Inulinase Mutants

[0044] Use a sterilized toothpick to remove the His grown on the MD plate + The transformant is copied to the same position of the YPD and the BMMYI plate, and the control bacteria GS115 / pPIC9K-inuI' (without error-prone PCR, the preparation process is the same as the product of Example 2) is inoculated on the BMMYI plate. Incubate at 30°C for 2 days, and save the grown YPD plate.

[0045] Plate primary screening: Induce the mutant strains on the BMMYI plate for 2-3 days. The strain with the transparent circle around the bacterium colony on the plate larger than the control bacterium GS115 / pPIC9K-inuI' is the mutant strain of the primary screening purpose.

[0046] 96-well plate re-screening: Add 300 μL of BMGY medium to a 1.8 mL / well (flat-bottomed) 96-well plate, and sterilize at 121° C. for 20 minutes. Into it, insert the primary screening target strain preserved on the YPD plate (simultaneously inse...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing fructooligosaccharides by fermenting inulase mutants. An enzymolysis technology for producing the high-quality fructooligosaccharides includes the optimal adding quantity of jerusalem artichoke, the optimal pH, the optimal concentration of a buffer solution, the optimal adding quantity of enzymes, the optimal temperature, the optimal stirring speed and the optimal stirring time. The formed enzymolysis technology can achieve the efficient production process in which the fructooligosaccharides account for more than 95.78% of the total sugar content. Inulase adopted in the technology is the novel inulase mutants and has high enzyme activity, the enzyme activity of fermentation liquor in a 30-m<3> system can be 60,000 U / ml, the production efficiency of the inulase can be remarkably improved, and production cost can be reduced. The formed enzymolysis technology for the fructooligosaccharides is a new technology; when the fructooligosaccharides are prepared with the technology, operation difficulty can be greatly lowered, and economic cost can be saved.

Description

Technical field: [0001] The invention belongs to the technical field of fermentation engineering, and in particular relates to a method for producing fructooligosaccharides by inulinase fermentation. Background technique: [0002] Fructooligosaccharides, referred to as FOS, also known as oligofructose or saccharotriose oligosaccharides, molecular formula: G-F-Fn, n=1~3 (G is glucose, F is fructose). It is a linear oligosaccharide composed of β-D-fructosyl linked by β-2,1 glycosidic bonds. At present, there are two methods for producing fructooligosaccharides in industry, fructooligosaccharides synthesized by enzymatic conversion of sucrose and whole fructooligosaccharides obtained by partial hydrolysis of inulin. The two are slightly different in structure, but their physiological functions are basically the same. Both have many beneficial functions to the human body, such as low calorie, promoting mineral absorption, not causing dental caries, lowering blood fat, laxative...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12P19/14
Inventor牛丹丹叶秀云
Owner福建福大百特生物科技有限公司