Aquatic products common virus detection kit
A virus detection and kit technology, which is applied in the field of common virus detection kits for aquatic products, can solve the time-consuming, labor-intensive and cost-intensive problems of virus detection technology, and achieve the effect of improving sensitivity and accuracy and simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0062] The common virus detection kit for aquatic products in this example consists of a primer set and a membrane chip. The primer set is a 7-fold PCR primer set. The 5'-3' base sequences of each pair of primers are as follows:
[0063] HAV: forward primer: ACAACTGTAAATGGAACCCC
[0064] Reverse primer: AGCAACATGGATGCCCAA;
[0065] Astrovirus: forward primer: GAATTTCCTCTCCGCCTGAC
[0066] Reverse primer: CGGTTGTTCTCATCAGAGTCC;
[0067] Norwalk virus: Forward primer: ACCTAACCACCCAGAACCCCTT
[0068] Reverse primer: CTCAGCATCCATTGTTCCAAAGCG;
[0069] Rotavirus: Forward primer: CTTTTCCATCCGAAATTAACAC
[0070] Reverse primer: AATATAAGGCAACCACGGTA;
[0071] Poliovirus: forward primer: AGGAGAAAATTATCCCACAAGC
[0072] Reverse primer: AAACATACTGGTTCAATACGGTG;
[0073] Coxsackievirus: forward primer: AAAACGTGGCAGCTAATGGA
[0074] Reverse primer: GCCACTCACCATAAGCAACA;
[0075] External reference gene: Forward primer: GATTTGGACCTGCGAGC
[0076] Reverse primer: GGTTGGCCAGGCGCGAAG...
Embodiment 2
[0120] The common virus detection kit for aquatic products in this example consists of a primer set, a membrane chip and auxiliary materials. The auxiliary materials are deoxyribonucleoside triphosphate (dNTP), EX-Taq polymerase (Polymerase) Positive oligonucleotide single-stranded DNA, the base sequence of the single strand is as follows: biotin-5'-CTGGTACTTTGGACAC
[0121] TCGTTCTTCTCGCACTGCTCATTATTGCTTCTGATCTGGATGC-3'.
[0122] The aquatic product prawns in this case were tested to contain Norwalk virus and poliovirus, and the test results were as follows: figure 2 Shown in B.
[0123] All the other are the same as embodiment one.
Embodiment 3
[0125] The common virus detection kit for aquatic products in this example consists of a primer set, a membrane chip, excipients and a preparation solution. The preparation solution is 10×PCR buffer solution, pre-hybridization solution, hybridization solution, washing solution, blocking solution, and streptavidin Pigment-labeled horseradish peroxidase and tetramethylbenzidine (TMB) chromogenic solution, wherein the pre-hybridization solution is 5×SSC, 0.1% SDS and 10×Denhardt’s; the hybridization solution is 5×SSC, 0.1% SDS, 5×Denhardt’s, 50% deionized formamide and 100ug / ml yeast tRNA; washing solutions were wash solution 1: 2×SSC and 0.1% SDS, wash solution 2: 0.5×SSC and 0.1% SDS, wash solution 3:100 mM Tris-HCl, pH 7.5, 150 mM NaCl, Wash 4: 100 mM Tris-HCl, pH 9.5, 100 mM NaCl and 100 mM MgCl 2 ; Blocking solution is 3% BSA, 100 mM Tris-HCl, PH7.5, 150 mM NaCl; Tetramethylbenzidine chromogenic solution is tetramethylbenzidine chromogenic solution A solution: 200mM sodium c...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More