Unlock instant, AI-driven research and patent intelligence for your innovation.

A method for screening high-quality black black cattle breeds and the primers and kits used

A kit and high-quality technology, applied in the field of animal molecular genetics, can solve the problems of low sensitivity of inspection technology, complicated operation process, unstable method, etc., and achieve the effect of solving limitations, high accuracy, and intuitive detection results

Active Publication Date: 2019-02-15
董雅娟
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there are few reports on methods for screening or cultivating high-quality Black Cattle breeds. At present, SSCP and common RFLP techniques are commonly used for single nucleotide polymorphisms (Single nucleotide polymorphisms, SNPs) detection and population Genetic polymorphism analysis, these methods are unstable, some mutations do not cause DNA bending, and molecular conformation does not change. Under normal conditions, these mutations may not be detected. Therefore, these techniques alone cannot prove that there is no mutation at all. In actual application, a considerable proportion of false negative results may be encountered; meanwhile, the sensitivity of the current inspection technique is not high, which is affected by various factors such as electrophoresis temperature, ionic strength (ie, the concentration of the electrophoresis buffer), gel concentration, glycerol concentration and interaction. The influence of the concentration of the coupling agent methylenebisacrylamide, etc., leads to poor repeatability; in addition, its operation process is complicated, which greatly limits its application in production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for screening high-quality black black cattle breeds and the primers and kits used
  • A method for screening high-quality black black cattle breeds and the primers and kits used
  • A method for screening high-quality black black cattle breeds and the primers and kits used

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1 Selection of genes used in screening high-quality cattle breeds

[0052] 1. Materials and methods

[0053] 1.1 Experimental animals

[0054] The test animals were 117 fattening Black Cattle cattle from Shandong Black Cattle Technology Co., Ltd. The fattening cycle was 40 months old, in the same batch and fattening environment, and the 12th to 13th ribs were taken after slaughter The longissimus intermedius muscle should be stored at low temperature for later use.

[0055] 1.2 Main instruments and reagents

[0056] 1.2.1 Main instruments

[0057] AlphaImager gel imaging analysis system, ep PCR machine, IKA high-speed colloidal homogenizer, SIGMA 3K-30 high-speed refrigerated centrifuge, Shanghai Fiber Inspection SZC-C fat analyzer, ELITE300 horizontal electrophoresis instrument, DYCP-31A horizontal electrophoresis tank, Bio-Tek ELX800Gene5 microplate reader, Milli-Q ultrapure water system, ELITE 300PLUS ordinary electrophoresis instrument, BP211D precision electronic b...

Embodiment 2

[0137] The PCR-RFLP method for screening high-quality cattle breeds is as follows:

[0138] 1. Take the ear tissue of the Black Cattle according to the method of Example 1 above, and extract the genomic DNA of Black Cattle Black Cattle by using the tissue genomic DNA extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. as PCR amplification Template DNA;

[0139] 2. Use PCR to amplify exon 2 of PID1 gene of Breckett black cattle to obtain PCR product. The primers used for amplification are as follows:

[0140] Upstream primer: 5’GTGACCTATCTGGGTAAGGTGCCC3’

[0141] Downstream primer: 5’TCAGCCATCATCAGATTCTAATTCCTGGG3’;

[0142] The PCR reaction system and conditions are as follows: template DNA (50ng / μL) 2.0μL, 10×buffer(Mg 2+ ) 5.0μL, dNTP (2mmol / L) 4.0μL, upstream and downstream primers (10pmol / 2μL) each 1.0μL, Taq enzyme (5U / μL) 0.3μL, add double distilled water to a total volume of 50.0μL. The PCR reaction conditions were as follows: pre-denaturation at 94°C for 7 min...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for screening high-quality bulls of Blackett black cattle. The method comprises the steps that a gene sequence of the second exon of a PID1 gene of the Blackett black cattle is subjected to PCR amplification, and the Blackett black cattle with the base at the 285th position of the second exon of the PID1 gene being G are selected as the high-quality bulls. The invention further discloses a primer and a kit demanded by screening. The method for screening the high-quality bulls by detecting PID1 gene base mutation is raised for the first time, and a new idea is provided for cultivating high-quality Blackett beef cattle breeds. A PCR-RFLP method is used preferentially to detect base mutation and genotype of the Blackett black cattle, the high-quality bulls can be screened out through the number of electrophoresis fragments, a sequencing technology for SNP screening and the PCR-RFLP technology are combined, and accordingly defects of instability of SSCP and limitations of ordinary RFLP are overcome; the method is simple and quick, cost is low, precision is high, detection results are visual, and popularization is facilitated.

Description

Technical field [0001] The invention relates to a method for screening high-quality breeds of Black Cattle cattle, a primer used for amplifying the second exon of PID1 gene, and a kit used for screening high-quality breeds, belonging to the technical field of animal molecular genetics. Background technique [0002] With the enrichment of food culture and the continuous improvement of people's living standards, more and more people are aware of the unique nutritional value of beef. Beef contains essential amino acids needed by the human body, has the characteristics of high protein, low cholesterol, and rich nutrition. With the increase of consumer groups, the proportion of beef in meat consumption has been rising year by year, and beef prices have continued to rise. While the total consumption is increasing, people have higher requirements for the quality of beef. "Snow beef" and "high-end beef" have gradually become fashionable consumption, and consumers' demand for high-end be...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12Q1/6888
Inventor 董雅娟钟世勋董懿为
Owner 董雅娟