A method for screening high-quality black black cattle breeds and the primers and kits used
A kit and high-quality technology, applied in the field of animal molecular genetics, can solve the problems of low sensitivity of inspection technology, complicated operation process, unstable method, etc., and achieve the effect of solving limitations, high accuracy, and intuitive detection results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] Example 1 Selection of genes used in screening high-quality cattle breeds
[0052] 1. Materials and methods
[0053] 1.1 Experimental animals
[0054] The test animals were 117 fattening Black Cattle cattle from Shandong Black Cattle Technology Co., Ltd. The fattening cycle was 40 months old, in the same batch and fattening environment, and the 12th to 13th ribs were taken after slaughter The longissimus intermedius muscle should be stored at low temperature for later use.
[0055] 1.2 Main instruments and reagents
[0056] 1.2.1 Main instruments
[0057] AlphaImager gel imaging analysis system, ep PCR machine, IKA high-speed colloidal homogenizer, SIGMA 3K-30 high-speed refrigerated centrifuge, Shanghai Fiber Inspection SZC-C fat analyzer, ELITE300 horizontal electrophoresis instrument, DYCP-31A horizontal electrophoresis tank, Bio-Tek ELX800Gene5 microplate reader, Milli-Q ultrapure water system, ELITE 300PLUS ordinary electrophoresis instrument, BP211D precision electronic b...
Embodiment 2
[0137] The PCR-RFLP method for screening high-quality cattle breeds is as follows:
[0138] 1. Take the ear tissue of the Black Cattle according to the method of Example 1 above, and extract the genomic DNA of Black Cattle Black Cattle by using the tissue genomic DNA extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. as PCR amplification Template DNA;
[0139] 2. Use PCR to amplify exon 2 of PID1 gene of Breckett black cattle to obtain PCR product. The primers used for amplification are as follows:
[0140] Upstream primer: 5’GTGACCTATCTGGGTAAGGTGCCC3’
[0141] Downstream primer: 5’TCAGCCATCATCAGATTCTAATTCCTGGG3’;
[0142] The PCR reaction system and conditions are as follows: template DNA (50ng / μL) 2.0μL, 10×buffer(Mg 2+ ) 5.0μL, dNTP (2mmol / L) 4.0μL, upstream and downstream primers (10pmol / 2μL) each 1.0μL, Taq enzyme (5U / μL) 0.3μL, add double distilled water to a total volume of 50.0μL. The PCR reaction conditions were as follows: pre-denaturation at 94°C for 7 min...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


