Application of simian virus 40 capsid protein VP1 serving as cell transmembrane protein

A capsid protein and membrane-penetrating protein technology, applied in the field of cell transduction, can solve the problems of low practical utilization, strong damage, and low efficiency

Active Publication Date: 2016-06-01
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF7 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional techniques for mediating exogenous substances into cells include electroporation, microinjection, virus delivery systems, repeated freeze-thaw techniques, liposome encapsulation, etc. heavily restricted
In addition, after the drug enters the cell, due to the degradation of lysosomes, the actual utilization is often very low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of simian virus 40 capsid protein VP1 serving as cell transmembrane protein
  • Application of simian virus 40 capsid protein VP1 serving as cell transmembrane protein
  • Application of simian virus 40 capsid protein VP1 serving as cell transmembrane protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Simian virus 40 capsid protein VP1 gene, its preparation steps are as follows:

[0042] Using the pSV21SphI-N1 plasmid (Lietal, Small, 2009, 5:718-726) as a template, PCR amplification obtained the VP1 gene fragment of the simian virus 40 capsid protein, and the obtained VP1 gene sequence is shown in SEQ ID NO.1, which encodes The amino acid sequence is shown in SEQ ID NO.2. The upstream primer used in PCR: VP1-S (NcoI): 5′CAGACCATGGATGAGAGGATCGCATCACCATCACCATCACGGATCTATGAAGATG3′, the downstream primer: VP1-A (SacI): 5′GCTTGAGCTCGCACTGCATTCTAGTTGTGG3′. PCR cycle conditions: denaturation at 94°C for 5 min; denaturation at 90°C for 1 min, annealing at 53°C for 40 s, extension at 72°C for 1 min and 30 s, and 30 cycle reactions; finally, extension at 72°C for 10 min. The amplified product was subjected to 1% agarose gel electrophoresis, the target band was excised under ultraviolet light, and the gel recovery and purification kit from Omega Company was used to recover. Th...

Embodiment 2

[0044] Application of simian virus 40 capsid protein VP1 as a cell-penetrating peptide / verification of membrane penetration:

[0045] (1) CaCl for pET28a-hisVP1 plasmid 2 Transformed into E.coliRosetta (DE3) competent cells using the method, pick a single clone from the plate and insert it into 5mL LB test tube culture medium, and culture at 200r / min at 37°C overnight. The next day, transfer to 5mLLB test tube medium according to the inoculation amount of 1%, shake culture at 200r / min at 37°C overnight, transfer to 500mLLB Erlenmeyer flask on the next day, shake at 37°C and 200r / min until OD600 Between 0.4 and 0.6, add IPTG to a final concentration of 1 mM, continue to induce culture at 25 ° C for 8 h, collect the bacteria, and use loading buffer (25 mM Tris-HCl pH 7.8, 500 mM NaCl, 5 mM imidazole, 5 % glycerol) washed once, resuspended in 40mL of binding buffer for ultrasonication, centrifuged at 10000r / min for 30min, the supernatant was loaded on the Ni2+-NTA affinity chrom...

Embodiment 3

[0050] The application of monkey virus 40 capsid protein VP1 in the transduction of fluorescent protein mCherry into cells, the steps are:

[0051] (1) The fluorescent protein mCherry gene was inserted into the pET28a-hisVP1 vector through SacI and XhoI double restriction sites, and the plasmid pET28a-VP1mCherry was constructed, and the double restriction restriction plasmid was successfully constructed ( Figure 1-b ).

[0052] (2) The plasmid pET28a-VP1mCherry was transformed into E.coliRosetta (DE3) competent cells, and the monoclonals were picked from the plate for expansion and cultured, induced by IPTG, and purified by Ni2+-NTA column affinity chromatography to obtain the fusion protein VP1-mCherry .

[0053] (3) fusion protein VP1-mCherry polyacrylamide gel electrophoresis, the molecular weight of VP1 protein is about 70kDa, the molecular weight of VP1-mCherry detected by polyacrylamide gel electrophoresis is consistent with the predicted value ( figure 2 Middle lane...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention discloses an application of a simian virus 40 capsid protein VP1 serving as a cell transmembrane protein. Firstly, the VP1 is revealed to be a cell-penetrating protein, and then the VP1 protein is subjected to fusion expression with other proteins and can carry an exogenous protein to penetrate through a cell membrane so as to enter cells and be localized in cytoplasm. An experiment of the invention proves that the VP1 protein can carry a mCherry fluorescent protein and a cancer suppressor protein to penetrate through a cell membrane so as to enter cells and be localized in cytoplasm. The invention provides a simple and efficient cell transduction system, and realizes subcellular localization in cytoplasm, and a constructed VP1-P53 protein is expected to have potential applications in the aspects of tumor treatment and the like.

Description

technical field [0001] The invention relates to the technical field of cell transduction, and more specifically relates to the application of simian virus 40 capsid protein VP1 as a cell penetrating protein. The main capsid protein VP1 of Simian virus 40 can penetrate the mammalian cell membrane, enter the cell and localize in the cytoplasm. The SV40VP1 protein is fused with other proteins, and VP1 can transduce the fused foreign protein into the cell and localize in the cytoplasm. Background technique [0002] With the development of molecular biology theory and technology, new molecular therapeutic measures based on gene therapy, targeted protein drugs or peptide drugs have emerged, but these therapeutic methods are often based on the delivery of macromolecular substances into cells. Due to the selective permeability of the cell membrane, substances with strong polarity and large molecular weight such as proteins, polypeptides and DNA cannot pass through freely, and must ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/025C07K19/00C12N15/37
Inventor 崔宗强张先恩林秀萍张治平高丁
Owner WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap