Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Saussurea involucrata cell squalene synthase (SiSQS) gene as well as products coded by same and application thereof

A technology of squalene synthase and cell shark, applied in the field of genetic engineering

Active Publication Date: 2016-06-08
DALIAN PRACTICAL BIOTECH +1
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no relevant research on the Tianshan Saussurea squalene synthase gene and its encoded amino acid sequence in this field

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Saussurea involucrata cell squalene synthase (SiSQS) gene as well as products coded by same and application thereof
  • Saussurea involucrata cell squalene synthase (SiSQS) gene as well as products coded by same and application thereof
  • Saussurea involucrata cell squalene synthase (SiSQS) gene as well as products coded by same and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Saussurea oleifera cell transcriptome sequencing

[0032] Trizol was used to extract the total RNA of Saussurea tianshanensis cells, and sequenced by the IlluminaHiseq2000 platform, a total of 14372403000nt data was produced. As a result, there are 148718 Unigenes in total, the total length is 138529450nt, the average length is 931nt, and the N50 reaches 1515nt. Unigene functional annotations, the Unigenes annotated to NR, NT, Swiss-Prot, KEGG, COG, and GO libraries are 77514, 63458, 49750, 45573, 28939, 55950, and the Unigenes on all annotations are 83169 . Prediction of coding protein frame (CDS), there are 75735 CDS compared to the protein library, 5305 predicted CDS, a total of 81040. Through the analysis of GO annotation, Blast comparative analysis and MEGA6.0 phylogenetic tree construction, the sequence of the squalene synthase gene family in Saussurea chinensis cells was obtained.

[0033] Said Saussurea tianshanensis cells are obtained according to ...

Embodiment 2

[0034] Cloning of the squalene synthase gene in Saussurea sauraceae cells of embodiment 2

[0035] For the cloning of SiSQS, the forward primer: P1: 5'ATGGGGAGTTTAAAAGCAGTGTTGA3', the reverse primer P2: 5'TTACAACGTAAGCTTGATTTTATTT3', and the full-length sequence of the squalene synthase SiSQS coding gene of Saussurea sauraceae cells were used as templates for PCR amplification. The amplification system is as follows: 10×Buffer2.5μL, dNTP (2.5mmol·L -1 ) 1 μL, 1 μL each of primers P1 and P2, TaqDNA polymerase (5U·L -1 ) 0.2 μL, 1 μL (about 20 ng) of the template, and make up the rest with sterile double distilled water. Reaction conditions: pre-denaturation at 94°C for 5min, 94°C for 30s, annealing at 56°C for 30s, extension at 72°C for 2min and 30s, extension at 72°C for 10min after 35 cycles, and storage at 4°C. So far, the clone of squalene synthase SiSQS gene of Saussurea chinensis has been obtained.

Embodiment 3

[0036] The bioinformatics analysis of embodiment 3SiSQS gene

[0037]The full-length cDNA of the Tianshan Snow Lotus squalene synthase gene SiSQS provided by the present invention is 1846 bp in length, and the detailed sequence is shown in SEQ ID NO.1 in the sequence listing, wherein the open reading frame is located at 222-1478 bp. The SiSQS gene sequence was searched for nucleotide homology in the Non-redundantGenBank+EMBL+DDBJ+PDB and Non-redundantGenBankCDStranslation+PDB+Swissprot+Superdate+PIR databases using the BLAST program in the NCBI database. The gene has homology with SQS in other species at the amino acid level, and has a typical Isoprenoid_Biosyn_C1superfamily domain. like figure 1 and figure 2 . in figure 1 Predictive analysis for SiSQS structural functional domain (from NCBI database); figure 2 SiSQS phylogenetic tree (neighbor-joining method).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides saussurea involucrata cell squalene synthase (SiSQS) gene as well as products coded by same and application thereof. The complementary deoxyribonucleic acid (cDNA) length of the SiSQS gene is 1846bp. A SiSQS recombinant expression vector is obtained by connecting the SiSQS gene and a prokaryotic expression vector, and SiSQS is prepared by the SiSQS recombinant expression vector; the SiSQS can be applied to squalene preparation taking farnesyl pyrophosphate as substrate. The SiSQS gene provided by the invention can be used for increasing the content of chemical component beta-sitosterol of saussurea involucrata cells by a genetic engineering technology, and is especially applied to the culture field of saussurea involucrata and cells and / or tissues of plants which belong to the species similar to the saussurea involucrata.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to the squalene synthase gene SiSQS of Saussurea chinensis cells and its coded product and application. Background technique [0002] The 2015 edition of "Chinese Pharmacopoeia" records that Tianshan Saussurea involucrate is derived from the dry aboveground part of Tianshan Saussurea involucrate, which is used to treat rheumatoid arthritis, joint pain, lung-cold cough, kidney and Abdominal pain and other diseases. Snow lotus is mainly produced in the alpine regions of Northwest and Southwest my country. Due to its special growth environment, it is difficult to cultivate, and wild Tianshan snow lotus resources are in an endangered state. Therefore, snow lotus cells have become a substitute for Tianshan snow lotus in recent years. The chemical components of Saussurea tianshanensis are diverse. The reported components are polysaccharides, flavonoids, alkaloids,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/54C12N9/10C12N15/11C12N5/10C12N15/82C12P33/00
CPCC12N9/10C12N15/8243C12P33/00C12Y205/01021
Inventor 黄璐琦袁媛查良平杨健刘爽刘雅萍陈晓霞蒋昌海
Owner DALIAN PRACTICAL BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com