Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of rice reproductive development gene MMD2 and method for restoring male sterility of rice

A technology of male sterility and male sterile lines, applied in the field of genetic engineering, can solve problems such as the limitation of the relationship between the restorer line and the maintainer line, the complex performance of three-line hybrid rice seeds, and the difficulty in screening excellent combinations

Active Publication Date: 2016-06-15
SHANGHAI JIAO TONG UNIV
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the performance of three-line hybrid rice seed dominance is complex, limited by the relationship between the restorer line and the maintainer line, making it difficult to select excellent combinations

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of rice reproductive development gene MMD2 and method for restoring male sterility of rice
  • Application of rice reproductive development gene MMD2 and method for restoring male sterility of rice
  • Application of rice reproductive development gene MMD2 and method for restoring male sterility of rice

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1, creation of rice male sterile strain

[0035] 1.1 Creating mmd2 rice male sterile lines by means of physical mutagenesis

[0036] The mmd2 mutation material of the present embodiment is to use 60 Mutagenesis of conventional japonica rice variety Wuyujing No. 7 (also known as 9522) by Coγ-rays with a treatment dose of 280Gy (Chen Liang, Chu Huangwei, Yuan Zheng, et al. 60 Isolation and preliminary genetic analysis of rice mutants induced by Coγ-Ray rays[ J]. Xiamen University Journal: Natural Science Edition, 2006, (S1): 82-85). Backcross the mutagenized mutants for three generations to obtain a stable inherited mmd2 mutant controlled by a recessive nuclear single gene. The mmd2 mutant was further backcrossed with 9522, and the phenotypes of all F1 generations were consistent with 9522, showing fertility. The segregation ratio of fertile and sterile plants in the F2 population produced after selfing of the F1 generation crossed between the mutant and t...

Embodiment 2

[0055] Embodiment 2, MMD2 gene expression characteristic analysis

[0056] Using various organ tissues of the source parent 9522 of the mmd2 mutant strain, RNA was extracted and reverse-transcribed to obtain the first strand of cDNA. The expression pattern of the MMD2 gene was determined by fluorescent quantitative PCR. The results showed that in roots, stems, leaves, and palea The expression of MMD2 gene can be detected in the anthers of different development stages, and the expression level is higher in the leaves and the early stage of anther development (Stage1-Stage10) ( image 3 ).

Embodiment 3

[0057] Embodiment 3, the method for recovering mmd2 mutant male sterility traits

[0058] Transferring the genomic nucleotide sequence encoding the MMD2 gene into the mutant mmd2 plant can restore the mutant to the wild-type phenotype.

[0059] Primers used from a rice BAC clone (OSJNBa0060P14):

[0060] Q69hb-F (SEQ ID NO.4): 5'CGGTACCCGGGGATCCGTACCGCAATCAACAAACAG3',

[0061] Q69hb-R (SEQ ID NO.5): 5'ACCTGTAATTCACACGTGTATTCGTCACCGTATTCGTT3',

[0062] A 5434bp (SEQ ID NO.3) genome sequence fragment of the MMD2 gene was amplified.

[0063] The fragment was connected with the binary vector pCAMBIA1301 vector used for transformation of rice through in-fusion through BamHI and PmaCI double enzyme cuts; the sequencing verification was correct, and the vector was introduced into Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 by electric shock to obtain MMD2 complements Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105, using genetic transformation means...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to application of a rice reproductive development gene MMD2 and a method for restoring male sterility of rice in the technical field of rice breeding. A sequence of the MMD2 gene is shown in SEQ ID NO.1, and an amino acid sequence encoded by the MMD2 gene is shown in SEQ ID NO.2. The application comprises the steps of enabling rice male reproductive development to be abnormal through gene variation or expression suppression, obtaining a rice male sterile line and producing hybrid seeds by adopting the rice male sterile line. The method for restoring male sterility caused by loss of functions of the MMD2 gene comprises the steps of amplifying the MMD2 gene by virtue of a primer, constructing a vector and transforming a mutant by adopting a genetic transformation method, wherein the mutant can be restored to a wild type phenotype. The obtained rice mutant has no abnormality in a nutrition growth stage and is abnormal in reproductive growth, so that complete infertility is caused; and when the rice mutant is applied to cross breeding, castration on a female parent can be eliminated, the production efficiency is greatly improved, and the labour cost is reduced, so that the rice mutant has important application values in agricultural production.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to the application of a rice reproductive development gene MMD2 and a method for restoring male sterility of rice. Background technique [0002] Rice is one of the main food crops in the world, and it is the most important food crop in my country. China is the largest rice producer and consumer in the world, and more than 60% of Chinese people use rice as a staple food. The annual sown area of ​​rice in my country exceeds 30 million hectares, accounting for 20% of the world and 30% of the national grain crop sown area. The level and stability of rice production are directly related to human life and social stability. [0003] Rice reproductive development is the most important period in the life history of rice, and it is also a critical period for the formation of rice yield and quality. In reproductive development, the development of stamens and pistils ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/84A01H5/00C12N15/66
CPCC07K14/415C12N15/66C12N15/8205C12N15/8216C12N15/8289C12N2840/102
Inventor 张大兵梁婉琪何漪袁政
Owner SHANGHAI JIAO TONG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More