Application of rice reproductive development gene MMD2 and method for restoring male sterility of rice
A technology of male sterility and male sterile lines, applied in the field of genetic engineering, can solve problems such as the limitation of the relationship between the restorer line and the maintainer line, the complex performance of three-line hybrid rice seeds, and the difficulty in screening excellent combinations
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Embodiment 1, creation of rice male sterile strain
[0035] 1.1 Creating mmd2 rice male sterile lines by means of physical mutagenesis
[0036] The mmd2 mutation material of the present embodiment is to use 60 Mutagenesis of conventional japonica rice variety Wuyujing No. 7 (also known as 9522) by Coγ-rays with a treatment dose of 280Gy (Chen Liang, Chu Huangwei, Yuan Zheng, et al. 60 Isolation and preliminary genetic analysis of rice mutants induced by Coγ-Ray rays[ J]. Xiamen University Journal: Natural Science Edition, 2006, (S1): 82-85). Backcross the mutagenized mutants for three generations to obtain a stable inherited mmd2 mutant controlled by a recessive nuclear single gene. The mmd2 mutant was further backcrossed with 9522, and the phenotypes of all F1 generations were consistent with 9522, showing fertility. The segregation ratio of fertile and sterile plants in the F2 population produced after selfing of the F1 generation crossed between the mutant and t...
Embodiment 2
[0055] Embodiment 2, MMD2 gene expression characteristic analysis
[0056] Using various organ tissues of the source parent 9522 of the mmd2 mutant strain, RNA was extracted and reverse-transcribed to obtain the first strand of cDNA. The expression pattern of the MMD2 gene was determined by fluorescent quantitative PCR. The results showed that in roots, stems, leaves, and palea The expression of MMD2 gene can be detected in the anthers of different development stages, and the expression level is higher in the leaves and the early stage of anther development (Stage1-Stage10) ( image 3 ).
Embodiment 3
[0057] Embodiment 3, the method for recovering mmd2 mutant male sterility traits
[0058] Transferring the genomic nucleotide sequence encoding the MMD2 gene into the mutant mmd2 plant can restore the mutant to the wild-type phenotype.
[0059] Primers used from a rice BAC clone (OSJNBa0060P14):
[0060] Q69hb-F (SEQ ID NO.4): 5'CGGTACCCGGGGATCCGTACCGCAATCAACAAACAG3',
[0061] Q69hb-R (SEQ ID NO.5): 5'ACCTGTAATTCACACGTGTATTCGTCACCGTATTCGTT3',
[0062] A 5434bp (SEQ ID NO.3) genome sequence fragment of the MMD2 gene was amplified.
[0063] The fragment was connected with the binary vector pCAMBIA1301 vector used for transformation of rice through in-fusion through BamHI and PmaCI double enzyme cuts; the sequencing verification was correct, and the vector was introduced into Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 by electric shock to obtain MMD2 complements Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105, using genetic transformation means...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com