Molecular markers related to the main effect QTL of anti-cracking angle trait in rapeseed and its application

A molecular marker, anti-cracking angle technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA / RNA fragments, etc. , to achieve the effect of speeding up the breeding process, clear location, convenient and fast detection method

Active Publication Date: 2019-07-16
INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The silique structure of the existing rape varieties in my country determines that it is easy to crack the corner kernels in the mature stage, and the loss caused by this generally accounts for about 5-10% of the total seed output; when the climate is relatively bad in the mature stage, the yield loss can be as high as 50%
At the same time, the burst rapeseed will germinate and form spontaneous seedlings when the conditions are suitable, which not only affects the growth of the next crop, but also easily causes biological confusion.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular markers related to the main effect QTL of anti-cracking angle trait in rapeseed and its application
  • Molecular markers related to the main effect QTL of anti-cracking angle trait in rapeseed and its application
  • Molecular markers related to the main effect QTL of anti-cracking angle trait in rapeseed and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Discovery of main effect QTL (qSRI.2) for anti-cracking angle

[0033] (1) Field experiment and phenotypic determination of anti-cracking angle index:

[0034]Field experiments were carried out at the Yangluo Experimental Station of the Chinese Academy of Agricultural Sciences Oil Plant Research Institute (Wuhan) from 2011 to the autumn of 2015, and at Qinghai University (Xining, Qinghai) from the summer of 2011 to 2015, and autumn sowing was carried out in Wuhan in mid-September every year. Harvest in early May of the following year, summer sowing in Qinghai in mid-May, and harvest in September. The sowing plot is flat and fertile, and the base fertilizer is evenly applied. The row length is 210cm, the plant spacing is 15cm, and the row spacing is 33cm. Cracking resistance index (SRI) of strains or single plants at maturity stage, identification method references (Peng Pengfei, Li Yunchang, Mei Desheng, Liu Daomin, Fu Li, Wang Hui, Sang Shifei, Chen Yufeng, Hu Qiong. ...

Embodiment 2

[0047] Application of a molecular marker primer related to the major QTL of anti-cracking angle trait in rapeseed in high-yield breeding:

[0048] 1. The experimental materials are as follows:

[0049] Two parental materials used for initial mapping: R1 and R2, DH population and BC4F2 single plant for further fine mapping.

[0050] 2. Primers for genotype detection:

[0051] BnS1: AGCTA AGAGC TGAAG CACGG; AGATG CTGAA ATTCG TCTGT GA.

[0052] BnS2: TCAAC TTGAC ATGTT CACTA ATAGT TT; CAATA GACAC GGAAA TGGGC.

[0053] 3. Genotype detection method

[0054] When 5 leaves were left, leaf DNA was extracted, and the working solution diluted to a concentration of 10 ng / μl was used for PCR amplification, and the obtained PCR products were detected by capillary electrophoresis. The amplification system and procedure of BnS1 and BnS2:

[0055] The PCR amplification system is: 2×Taq Mix 5ul, forward primer (10uM / ul) 1μl, reverse primer (10uM / ul) 1μl, gDNA 1μl, ddH2O 2μl, Total 10μl. B...

Embodiment 3

[0062] Example 3: Universality of BnS1 and BnS2 primer pairs:

[0063] 1. The experimental materials are as follows:

[0064] 35 rapeseed materials with anti-cracking angle coefficients ranging from 0.02 to 0.49 were selected, as shown in Table 3.

[0065] 2. Genotype detection method

[0066] When 5 leaves were left, leaf DNA was extracted, and the working solution diluted to a concentration of 10 ng / μl was used for PCR amplification, and the obtained PCR products were detected by capillary electrophoresis. The amplification system and procedure of BnS1 and BnS2:

[0067] The PCR amplification system is: 2×Taq Mix 5ul, forward primer (10uM / ul) 1μl, reverse primer (10uM / ul) 1μl, gDNA 1μl, ddH2O 2μl, Total 10μl. BnS1 is a red fluorescent primer, and BnS2 is a blue fluorescent primer.

[0068] PCR reaction conditions: 94°C, 3min; 94°C, 30s; 58°C, 30s, 72°C, 45s; 35 cycles; 72°C, 10min; 4°C, till use.

[0069] Capillary electrophoresis on the machine, the machine model is AB...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker related to oilseed rape pod-shattering resistance quantitative trait loci (QTL) and application. The magnitude of phenotype interpretation variation reaches 38%. A corresponding sectional SSR molecular marker is developed. The SSR molecular marker related to oilseed rape pod-shattering is BnS1 and BnS2, and the primer sequence of BnS1F is AGCTAAGAGCTGAAGCACGG, the primer sequence of BnS1R is AGATGCTGAAATTCGTCTGTGA, the primer sequence of BnS2F is TCAACTTGACATGTTCACTAATAGTTT, and the primer sequence of BnS2R is CAATAGACACGGAAATGGGC. By means of the molecular marker, the efficiency of screening advanced-line backcrossing imported pod-shattering-resistant strains reaches 93.4%, and the molecular marker can be applied to oilseed rape genetic improvement; the method and the marker have wide application prospect in the field of oilseed rape pod-shattering resistance breeding.

Description

technical field [0001] The invention relates to a major QTL (qSRI.2) for anti-cracking angle on the rapeseed genome, in particular to a molecular marker closely linked to the main QTL site for anti-cracking angle of Brassica napus and its application in crop genetics and breeding. Background technique [0002] Rapeseed is a dominant oil crop in my country. Its planting area and total output rank among the top in the world, and its total output is close to one-third of the world. However, the degree of mechanization of rapeseed in my country is still very low, which has become one of the main factors restricting the development of rapeseed production in my country. At present, rapeseed production is still mainly manual. Rapeseed production based on labor input is labor-intensive and time-consuming. Labor force accounts for nearly 50% of the production cost of rapeseed. The cost of rapeseed planting has increased significantly, and compared with the same season crops such as wh...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor胡琼刘佳汪文祥王会李云昌梅德圣周日金付丽
OwnerINST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI