GRP78 gene targeted RNA interference recombinant lentivirus vectors and construction method
A technology for recombining lentiviruses and genes, which can be applied in the field of biomedicine and can solve very few problems.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1 Construction of lentiviral vector targeting GRP78 gene
[0031] 1. Design and synthesis of oligonucleotides
[0032] Design 4 interference sequences targeting the GRP78 gene (NM_005347) (see Table 1), and synthesize the corresponding single-stranded DNA
[0033] Table 1 Targeting GRP78 gene RNA interference sequence
[0034] sequence name
[0035] The 3' end of the shRNA oligonucleotide is TTTTT, which serves as the termination signal of the RNA polymerase type III promoter U6, and its 5' and 3' ends are the restriction enzyme sites of BamHI and EcoRI respectively. In the plv-shRNA template The loop structure uses CTCGAG. The respective single-stranded DNA synthesis fragments are as follows:
[0036] (1) GRP78-homo-U1 oligonucleotide sequence 1:
[0037] Sense strand: 5'GATCCCTTGTTGGTGGCTCGACTCGACTCGAGTCGAGTCGAGCCACCAACAAGTTTTTG3'
[0038] Antisense strand: 5'AATTCAAAAACTTGTTGGTGGCTCGACTCGACTCGAGTCGAGTCGAGCCACCAACAAGG3'
[0039] (2) GRP78-homo-...
Embodiment 2
[0059] Example 2 Transient transformation of 293T cells by RNA interference lentivirus
[0060] The four interfering lentiviral plasmids were transfected into 293T cells by transient transfection. 293T cells were cultured in high-glucose DMEM medium containing 10% FBS in a 37°C, 5% CO2 incubator. Digest 293T cells 1 day before transfection, count, inoculate cells into 35mm culture dishes, each culture dish inoculates 6×10 5 The next day, use DMEM medium without FBS to prepare calcium transfer reagent and RNA interference plasmid respectively, add 16 μl calcium transfer reagent to each 84 μl medium, add 4 μg plasmid to each 100 μl medium, mix well and transfer calcium Gently mix the solution and plasmid solution, let stand at room temperature for 10 minutes, add dropwise to the petri dish, incubate in a 5% CO2 incubator at 37°C for 24 hours, replace with fresh high-sugar DMEM medium containing 10% FBS and continue to cultivate After 48 hours, the cells were collected and the ...
Embodiment 3
[0061] Example 3 Extraction of total RNA, synthesis of cDNA and RT-PCR detection of RNA interference effect
[0062] 1 μg of RNA was reverse-transcribed into cDNA, and the expression level of GRP78 was detected by fluorescent quantitative PCR method. Beta-actin was used as an internal reference. The primer sequences used by fluorescent quantitative PCR were shown in Table 2. GRP78 expression levels of RNA interference-seq samples. The RNA interference sequence with the lowest expression level was screened out. test results (see image 3 ) shows that the U4 sequence has the lowest expression level of the GRP78 gene, indicating that the U4 sequence has the best effect of RNA interference.
[0063] Table 2. GRP78 and beta-actin primer probe design
[0064] Primer name
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More