A kind of omega-transaminase mutant that introduces disulfide bond and its application
A technology of mutant and transaminase, which is applied in the field of ω-transaminase mutants, can solve the problem that the thermal stability needs to be further improved, and achieve the effect of improving the thermal stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] First upload the PDB file (PDB ID: 4CE5) of Aspergillus terreus ω-transaminase to Disulfide by Design (DbD, http: / / cptweb.cpt.wayne.edu / DbD2) and DisulfideBonds in Proteins (MODIP, http : / / caps.ncbs.res.in / dsdbase / modip.html) website, the above software fully considered the C-S bond rotation angle of two cysteines, C α distance between and C β There are 8 feasible sites for introducing disulfide bonds by using bioinformatics calculations to analyze bond length, bond angle and energy, namely R131C and D134C, N25C and A28C, D113C and Y146C, E213C and V234C , A44C and L48C, M150C and M280C, A32C and F142C, R161C and Y201C. According to the crystal structure of ω-transaminase, the temperature factor (B-factor) value of amino acid residues in the G129-D134 region is higher. For proteins, if the B-factor value of a certain amino acid residue is higher, it indicates that the The structure where the amino acid residues are located is more unstable. Therefore, in the G129-D13...
Embodiment 2
[0031] Site-directed mutagenesis was performed on R131C and D134C of the ω-transaminase gene locus in turn by using site-directed mutagenesis PCR method. The primers for site-directed mutagenesis are shown in Table 1, thereby obtaining a mutant containing two cysteines at the same time. The nucleotide sequence of the mutant was verified by sequencing to be mutated at the 497th and 499th codons, and the codes of arginine (R, Arg) and aspartic acid (D, Asp) were encoded by the 131st and 134th positions The codons CGT and GAT are all mutated to the codon TGC encoding cysteine (C, Cys).
[0032] Table 1 Primers for site-directed mutagenesis.
[0033] Primer name Sequence 5'→3' R131C-F GGTGCGAGGAACTTGCCCGGAAGATATAGTG R131C-R CTATATCTTCCGGGCAAGTTCCTCGCACCCC D134C-F GGAACTTGCCCGGAATGCATAGTGAACAACCTGTAC D134C-R ACAGGTTGTTCACTATGCATTCCGGGCAAGTTCCTC
[0034]Using the pET28a-ω-opt-TA plasmid containing the wild-type ω-transaminase gene as a ...
Embodiment 3
[0038] Transform the plasmid with the double mutant ω-transaminase mutant gene sequenced correctly in Example 2 into E.coliBL21(DE3), pick a single colony and inoculate it into a test tube with 5 mL of LB liquid medium, at 37°C, Cultivate overnight under the condition of 200r / min. Inoculate the 100mL LB medium (10g of tryptone, 5g of yeast powder, 10g of sodium chloride, and adjust the pH of ), cultivated to OD at 37℃, 180r / min 600 When the value is 0.4-0.6, add an appropriate volume of IPTG (final concentration: 0.5mmol / L), and then induce culture at 25°C and 150r / min for 18h, then collect the bacteria.
[0039] The collected bacteria were washed twice with phosphate buffer, resuspended in cell-breaking buffer, and ultrasonically disrupted. The working conditions of ultrasonic cell disruption were: power 300W, working for 3s, intermittent for 6s, and ultrasonicating for 8min. The broken cells were centrifuged at 12000r / min and 4°C for 30min, and the supernatant was collecte...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com