Fusion protein sHA1-Fc and application
A fusion protein, sha1-fc technology, applied in the direction of application, fusion peptide, hybrid peptide, etc., can solve problems such as weak mucosal immune response, achieve the effect of protecting animal body, stimulating system immunity, and simple and fast operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Expression of fusion protein sHA1-Fc
[0049] 1. Extract chicken spleen tissue RNA according to the routine protocol and reverse transcribe to obtain cDNA.
[0050] 2. Primer Design
[0051] According to the recombinant plasmid pFastBac HTB-sHA1-Linker-wFc (Dangwei, 2014) preserved in the laboratory, a pair of primers were designed, wherein the sHA1 upstream primer (sHA1-up) introduced the XbaI restriction site, and the sHA1 downstream primer (sHA1-down ) contains a 42bp Linker sequence to amplify the sHA1 sequence.
[0052] sHA1-up: 5'-CTAG TCTAGA ATGGAGAAAATAGTGCTTC-3', the underlined part in italics is XbaI.
[0053] sHA1-down: 5'- AGATCCCGAGCCACCTCCTCCGGACCCCACCCCCGCCTGATCC TCTTTTTCTTCTTCTCT-3', the underlined part in italics is Linker.
[0054] A pair of primers were designed according to the chicken heavy chain sequence recorded in GenBank (GenBank: X07174), wherein the Fc upstream primer (Fc-up) introduced the 42bp Linker sequence, and the Fc downstream pr...
Embodiment 2
[0109] Application of sHA1-Fc fusion protein:
[0110] Detection of sHA1-Fc fusion protein crossing the mucous membrane barrier of chicken respiratory tract
[0111] Biotin-labeled sHA1-Fc fusion protein, GST-HA1 fusion protein and chicken IgY were inoculated into 10-day-old Hai-Line gray laying hen chicks by intranasal drops, and the sHA1-Fc content in serum was found to be much higher than that of GST by ELISA after 8 hours -HA1, the difference between the two was extremely significant (P Figure 5 ).
[0112] Detection of Immune Efficacy of Intranasally and Subcutaneously Inoculated Chickens
[0113] 175 7-day-old Hai-Line gray layer chickens were randomly divided into 7 groups, 25 in each group, and the grouping situation and immunization dose are shown in Table 4 and Table 5. The first immunization at the 7-day-old age was followed by a two-week interval (21-day-old) booster One time of immunization, the immunization time and blood collection time are shown in Table 6. ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com