Unlock instant, AI-driven research and patent intelligence for your innovation.

Fusion protein sHA1-Fc and application

A fusion protein, sha1-fc technology, applied in the direction of application, fusion peptide, hybrid peptide, etc., can solve problems such as weak mucosal immune response, achieve the effect of protecting animal body, stimulating system immunity, and simple and fast operation

Inactive Publication Date: 2016-11-16
HUAZHONG AGRI UNIV
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, most vaccines are administered by intramuscular or subcutaneous route, although injection can induce a strong lineage immune response, but only a very weak mucosal immune response

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein sHA1-Fc and application
  • Fusion protein sHA1-Fc and application
  • Fusion protein sHA1-Fc and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Expression of fusion protein sHA1-Fc

[0049] 1. Extract chicken spleen tissue RNA according to the routine protocol and reverse transcribe to obtain cDNA.

[0050] 2. Primer Design

[0051] According to the recombinant plasmid pFastBac HTB-sHA1-Linker-wFc (Dangwei, 2014) preserved in the laboratory, a pair of primers were designed, wherein the sHA1 upstream primer (sHA1-up) introduced the XbaI restriction site, and the sHA1 downstream primer (sHA1-down ) contains a 42bp Linker sequence to amplify the sHA1 sequence.

[0052] sHA1-up: 5'-CTAG TCTAGA ATGGAGAAAATAGTGCTTC-3', the underlined part in italics is XbaI.

[0053] sHA1-down: 5'- AGATCCCGAGCCACCTCCTCCGGACCCCACCCCCGCCTGATCC TCTTTTTCTTCTTCTCT-3', the underlined part in italics is Linker.

[0054] A pair of primers were designed according to the chicken heavy chain sequence recorded in GenBank (GenBank: X07174), wherein the Fc upstream primer (Fc-up) introduced the 42bp Linker sequence, and the Fc downstream pr...

Embodiment 2

[0109] Application of sHA1-Fc fusion protein:

[0110] Detection of sHA1-Fc fusion protein crossing the mucous membrane barrier of chicken respiratory tract

[0111] Biotin-labeled sHA1-Fc fusion protein, GST-HA1 fusion protein and chicken IgY were inoculated into 10-day-old Hai-Line gray laying hen chicks by intranasal drops, and the sHA1-Fc content in serum was found to be much higher than that of GST by ELISA after 8 hours -HA1, the difference between the two was extremely significant (P Figure 5 ).

[0112] Detection of Immune Efficacy of Intranasally and Subcutaneously Inoculated Chickens

[0113] 175 7-day-old Hai-Line gray layer chickens were randomly divided into 7 groups, 25 in each group, and the grouping situation and immunization dose are shown in Table 4 and Table 5. The first immunization at the 7-day-old age was followed by a two-week interval (21-day-old) booster One time of immunization, the immunization time and blood collection time are shown in Table 6. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses fusion protein sHA1-Fc and an application. The fusion protein sHA1-Fc of a highly pathogenic AIV (avian influenza virus) H5N1 and a chicken IgY Fc fragment is expressed by a Bacto-Bac expression system, has a molecular structure similar to IgY, and can penetrate a respiratory tract mucosal barrier of a chicken to enter the body under transfer of FcRy expressed in epithelial cells. A sequence of an sHA1-Fc fusion gene is represented as SEQ ID NO:1. The fusion protein is supplemented with a mucosal adjuvant and inoculates the chicken through nasal inhalation, thereby being capable of triggering an organism to generate effective mucosal immunity and triggering systemic immunity of the organism. Therefore, the organism is enabled to obtain anti-AIV local specific immunity and systemic immunity, the immune effect of the fusion protein is better than that of a commercial inactivated virus vaccine, and a new strategy is provided for development of a novel mucosal vaccine for poultry bird flu and other infectious diseases.

Description

technical field [0001] The invention belongs to the technical field of animal genetic engineering vaccine preparation, and relates to related fields such as animal molecular biology, immunology, biotechnology and the like. It specifically relates to the fusion protein sHA1-Fc and its application. Background technique [0002] Avian influenza (Avian influenza) is the abbreviation of avian influenza. It is an acute respiratory infectious disease caused by influenza A virus. Infection of mammals and other mammals can also infect humans, and even cause death, which seriously endangers human health. Since its discovery in the 19th century, about 20% of children and 5% of adults in the world have symptoms of infection every year, and an average of 3-4 large-scale epidemics have occurred every century, which has brought huge losses and harm to the world. attracted great attention from the world. Avian influenza virus is a single-stranded negative-sense RNA virus belonging to the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/866A61K39/145A61K47/48A61P31/16
CPCA61K39/12C07K14/005C07K2319/30C12N15/62C12N15/86C12N2710/14043C12N2760/16122C12N2760/16134
Inventor 李自力乔静宋娇阳王颖殷学焕毕丁仁
Owner HUAZHONG AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More