Monocotyledon plant gene knockout vector based on CRISPR/Cas9 technology, and applications thereof
What is AI technical title?
AI technical title is built by Patsnap AI team. It summarizes the technical point description of the patent document.
A monocotyledonous plant, gene knockout technology, applied in the biological field, can solve the problems of long cycle, inability to meet high-throughput plant genes, high cost, etc.
Inactive Publication Date: 2016-11-30
内蒙古中科正标生物科技有限责任公司
View PDF2 Cites 36 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
In terms of the commonly used Agrobacterium plant transformation, the construction process of the plant gene knockoutvector system based on CRISPR / Cas9 technology is relatively cumbersome, requiring multiple steps to integrate each part into the binary vector
In some reported CRISPR / Cas9 systems, the sgRNA is first inserted into the pATU6-26SK / pOsU6SK vector with the help of the restriction endonuclease BbsI, and then the AtU6-sgRNA fragment is obtained by restriction endonuclease KpnI and SalI or KpnI The OsU6-sgRNA fragment was obtained by double digestion with HindIII, and at the same time the digested SalI-Cas9-EcoRI or HindIII-Cas9-EcoRI fragment was connected with the linearized plasmid pCAMBIA1300 digested with KpnI and EcoRI to construct a binary vector. The construction process of this system is relatively complicated and the cycle is long (ZY Feng, JK Zhu et al., 2013); in addition, there is a synthetic method to directly synthesize the promoter and sgRNA unit, and then construct it on the binary vector. High, long period (Wenzhi Jiang et al.,2013)
In terms of gene gun transformation, the reported systems are to co-wrap the pU6-gRNA or pU3-gRNA vector and the Cas9 vector into the plant tissue, which is relatively expensive.
For the above systems, to complete the construction of a plant gene CRISPR / Cas9 knockout vector, either the cost is high or the process is cumbersome, and it cannot meet the needs of high-throughput plant gene CRISPR / Cas9 knockout vector construction
[0004] There is also a system that integrates the promoter, sgRNA scaffold and Cas9 fragments into a binary vector, and selects Bsa I as the insertion site, but the defect of this system is that there is SpR (spectinomycin resistance) between the two Bsa Is. gene spectinomycin resistance gene) fragment, during the construction process, it needs to be digested with Bsa I to recover the linearized vector, and then connected to the target sites (target sites) (HL Xing, L Dong et al., 2014)
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0040] Example 1: Knockout and verification of rice albino gene
[0041] 1. Construction of rice albinism gene OsPDS knockout vector
[0042] 1. Design a special target sequence according to the rice albinism gene OsPDS sequence and sgRNA design tool, the sequence is as follows:
[0043] OsPDS-oligo1: GGCAGTTGGTCTTTGCTCCTGCAG (SEQ ID NO: 7)
[0044] OsPDS-oligo2: AAACCTGCAGGAGCAAAGACCAAC (SEQ ID NO: 8)
[0045] 2. Perform the degradation phosphorylation process of the designed target oligos according to the following conditions:
[0048] Complete the reaction process on the PCR instrument according to the following procedures:
[0049]
[0050] 3. Digest the pCAMBIA1300-OsU3(Aar I)-Cas9 plasmid with Aar I enzyme to obtain a linearized vector, and dephosphorylate it with CIP enzyme to avoid self-ligation.
[0051] 4. Dilute the annealed phosphorylated product 100 times, and take 2 μl for T4 ligation with the...
Embodiment 2
[0060] Example 2: Knockout and verification of rice Gn1a gene
[0061] 1. Design a special target sequence according to the rice gene Gn1a sequence and sgRNA design tool, the sequence is as follows:
[0062] Gn1a-2-oligo1: GGCAGCGGCCAGGCCTTCCGCCA (SEQ ID NO: 9)
[0063] Gn1a-2-oligo2:AAACTGGCGGAAGGCCTGGCCGC (SEQ ID NO: 10)
[0064] 2. According to the steps in Example 1, the knockout vector of Gn1a was successfully constructed.
[0065] 3. Transfer the knockout vector to Agrobacterium, and complete the whole tissue culture process to obtain transgenic positive seedlings for detection and verification.
[0066] 4. Detection of Gn1a transgenic positive plants: using Gn1a-F / R primers
[0067] Gn1a-F: 5'-GATTGATTGATTGATAATGAAGC-3' (SEQ ID NO: 11);
[0068] Gn1a-R: 5'-CCTATACCTTAATTACCTC-3' (SEQ ID NO: 12)
[0069] Perform PCR amplification of the target fragment, and sequence the PCR product. The PCR reaction conditions are 95°C, 30s; 55°C, 30s; 72°C, 40s; 35cycles.
[0070]...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention discloses a plantgene knockout vector based on a CRISPR / Cas9 technology. The monocotyledonplantgene knockout vector is characterized in that the plantgene knockout vector is a monocotyledon plant CRISPR / Cas9 knockout vector pCambin1300-OsU3-Cas9, and contains the AarI insertion site. According to the present invention, with the CRISPR / Cas9 plant knockout double-component vector pCambin1300-OsU3-2x35s-Cas9 formed from a sgRNA-OsU3 structure sequence comprising the AarI insertion site and a 2x35s-Cas9-ter sequence, the purpose of the efficient and rapid construction of the monocotyledon plant gene knockout vector can be achieved through the one-step digestion linkage method; and the provided CRISPR / Cas9 knockout vector pCambin1300-OsU3-2x35s-Cas9 has characteristics of high targeting efficiency and extremely low undershoot efficiency, and can be used for plant target gene knockout or can be used for plant gene editing in a kit form.
Description
Technical field: [0001] The invention belongs to the field of biotechnology, and in particular relates to a monocot gene knockout vector based on CRISPR / Cas9 technology and an application thereof. Background technique [0002] Type II CRISPR / Cas9 system is an acquired immune system from Streptococcus, which can resist the invasion of foreign genes. After artificial modification, this system has been widely used in animals and plants. It is mainly composed of CRISPR ( C lustered R regularly I Interspaced S hort P alindromic R epeats) and specific Cas9 protein composition. CRISPR is a cluster of regularly interspaced short palindromic DNA repeats, which consists of a series of short highly conserved direct repeats and sequence intervals of similar length. Cas9 protein is a multi-domain protein consisting of 1409 amino acids, containing two nuclease domains RuvC-like and HNH. The CRISPR / Cas9 system was first successfully applied to genome editing in eukaryotic cells by...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.