interference plasmid pHX RNAi applied in specificity silent gene in filamentous fungi

A filamentous fungus, gene silencing technology, applied in the field of genetic engineering, to achieve good application prospects, efficient and stable silencing effect

Inactive Publication Date: 2017-01-04
SHANDONG UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In view of the current situation that the silencing of some genes in filamentous fungi cannot be directly achieved by means of knockout, the problem to be solved in the present invention is to provide an interference plasmid pHX-RNAi that is applied to specific gene silencing in filamentous fungi

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • interference plasmid pHX RNAi applied in specificity silent gene in filamentous fungi
  • interference plasmid pHX RNAi applied in specificity silent gene in filamentous fungi
  • interference plasmid pHX RNAi applied in specificity silent gene in filamentous fungi

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0065] (1) Preparation of protoplasts

[0066] ① Take freshly sporulated Penicillium oxalicum plate or slope, and wash the conidia with sterile saline (0.9% NaCl, 0.05% Tween) to prepare the Penicillium oxalicum conidia suspension.

[0067] ②Cover a layer of cellophane on the plate of Vogel's basic medium (2% glucose as carbon source), spread it with a glass rod, add 50-100 μl of spore suspension on the cellophane, and spread evenly. Do 8-10 similar treatments and incubate at 30°C for 12-15h.

[0068]③Add 0.1g lyase (Lysing Enzymes from Trichoderma harzianum, Sigma product number L1412) to 20ml solution 1 (solution 1: 1.2M sorbitol, 0.1M KH 2 PO 4 , pH 5.6), shake gently, and filter-sterilize with a 0.2 μm filter into a petri dish or test tube.

[0069] ④Pipe 2-3ml of lyase solution into a sterile petri dish, cover the surface of the solution with a layer of cellophane with Penicillium oxalicum bacteria, then add 2-3ml of lyase solution, and stack 6-7 layers in this order ...

Embodiment 1

[0098] The construction of embodiment 1 interference carrier pHX-RNAi

[0099] (1) Element cloning in interference vector pHX-RNAi

[0100] Using the Penicillium oxalicum 114-2 genome as a template, PpgmC with the corresponding restriction site sequence was amplified. Using p-silent as a template to amplify hph and TtrpC, the primer sequences are as follows.

[0101] PpgmC upstream primer: Ppgm-F (SphI): AC ATGCAT GCCCGACTCATTACATACCTCCA

[0102] PpgmC downstream primer: Ppgm-R (PstI): AA CTGCAG GAGGTGGTGAAGGTTGGATTTG

[0103] TtrpC upstream primer: TtrpC-F (SacI): CG GAGCTC ACTTAACGTTACTGAAATCAT

[0104] TtrpC downstream primer: TtrpC-R (EcoRI): CG GAATTC CTAGAGCGGCCGCAACCCAG

[0105] Hph upstream primer: Hphs-F (HindⅢ): CCC AAGCTT CGACCTTAACTGATATTGAA

[0106] Hph downstream primer: Hphs-R (SphI): ACAT GCATGC CAACCCAGGGCTGGTGACGG

[0107] (2) Construction of plasmid K-hph

[0108] The hygromycin-resistant hph expression cassette hph was connected into the s...

Embodiment 2

[0115] The construction of embodiment 2 single gene interference plasmid pHX-amyi

[0116] (1) Cloning of fragments

[0117] Using the 114-2 genome as a template, the amy15A sequence with corresponding restriction sites was amplified as an interference fragment, in which iamyF1(PstI) / iamyR1(BamHI) was used to amplify amy15Ai+, iamyF2(XbaI) / iamyR2(SacI) Used to amplify amy15Ai-, the primer sequences are as follows.

[0118] iamyF1(PstI): AACTGCAGTGAAAAATGACCCTCTAATGAA

[0119] iamyR1(BamHI): CGCGGATCCCCAAGCACCGGTGAAGGCG

[0120] iamyR2(SacI): CGGAGCTCCCAAGCACCGGTGAAGGCG

[0121] iamyF2(XbaI): GCTCTAGATGAAAAATGACCCTCTAATGAA

[0122] After gel electrophoresis, the PCR amplification products were cut and purified according to the instructions of the kit. The nucleotide sequences of the amy15A interference fragment are shown in SEQ ID No.2 and SEQ ID No.3.

[0123] (2) Construction of amy15A interference plasmid pHX-amyi

[0124] The amy15A-fragment and the interference plas...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This invention discloses the interference plasmid pHX RNAi applied in specificity silent gene in filamentous fungi. The plasmid includes an integrated hygromycin resistance gene expression cassette, a promotor from penicllium oxalicum and an intron structure from penicllium oxalicum; the nucleotide sequence of the interference plasmid is shown in SEQ iD No. 1. This invention also publicizes the application of the plasmid in the single-gene or polygenes expression silence that is difficult to knock out in the filamentous fungi penicllium oxalicum. This invention sets the amylase gene amy15A as the example to prove the high stability of the interference plasmid pHX RNAi and sets the amy15A and cel7A-2 double genes interference as the example to verify the advantages of pHX RNAi in applying for polygene silence. SDS-PAGE chitinase activity and RT-qPCR testing result indicate that RNA interference plays a remarkable and stable role in the post-transcription level, which predicts the promising application prospect of the interference plasmid in filamentous fungi.

Description

technical field [0001] The present invention relates to a carrier for genetic modification in fungi, in particular to a carrier for single gene or multi-gene silencing of a specific gene that is difficult to knock out in filamentous fungi, that is, a carrier for specific gene modification in filamentous fungi. The invention relates to an interference plasmid pHX-RNAi for sexually silencing genes, belonging to the field of genetic engineering. Background technique [0002] RNA interference (RNA interference, RNAi) refers to the post-transcriptional gene silencing mechanism induced by double-stranded RNA (double-stranded RNA, dsRNA) or MicroRNA (miRNA), which degrades mRNA by cutting dsRNA in the body and affects the expression of target genes ( Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, et al.1998.Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.Nature 391:806-811.). RNAi technology can specifically close the specific gene exp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/80C12N15/65C12R1/80
CPCC12N15/65C12N15/80
Inventor宋欣薛海曌
OwnerSHANDONG UNIV