Alkaline pectinase producing recombinant bacteria and application thereof
A technology of pectinase and alkaline, applied in the field of genetic engineering, can solve the problems of low expression level, restriction of high-efficiency expression of alkaline pectinase, high-efficiency expression of alkaline pectinase and influence on properties, etc., to achieve high-efficiency expression Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Embodiment 1: Construction and identification of recombinant bacteria
[0038] Using the gene K314Mopt as the starting control gene, the alkaline pectinase gene PGL / N185Q with deleted glycosylation sites was transformed by point mutation to obtain the alkaline pectinase gene as shown in SEQ ID NO.1, and then primers were designed, The alkaline pectinase gene N185Q was obtained by PCR, and cloned into the expression vector pPIC9K to obtain the recombinant plasmid pPIC9K-N185Q. The recombinant vector was transformed into Pichia pastoris GS115, and the recombinant strain Pichia pastorisGS115-pPIC9K-N185Q was obtained through screening and identification.
[0039] Primers are as follows:
[0040] PGL-F: GCTGAAGCTTACGTAGAATTCGCTGATTTGGGTCATCAAACACTTG
[0041] PGL-R: AAGGCGAATTAATTCGCGGCCGCTTAGTTCAATTTTCCAGCACCTGCT
[0042] The gene was transferred into Pichia pastoris cells by electroporation. The specific steps are as follows: Pick a single colony of yeast recipient bacter...
Embodiment 2
[0044] Embodiment 2: shake flask fermentation of genetically engineered strains
[0045] Cultivation method: After seed activation, the strain was inoculated into the basic fermentation medium YPD, cultured at 30°C and 220rpm for 14h, then transferred to the optimized growth medium BMGY and cultured at 30°C and 220rpm for 24h, and then the strain Transfer to induction medium BMMY at 22°C and 220rpm, add 1.5% (1.5mL methanol / 100mL fermentation broth) methanol every 24h to induce the expression of alkaline pectinase.
[0046] Select Beyontian SDS-PAGE gel electrophoresis kit to prepare 12% separating gel and 5% stacking gel. For specific operation methods, please refer to the product manual. The sample was mixed with 5× loading buffer at a volume ratio of 4:1, boiled in water bath for 10 min, and loaded after cooling. During electrophoresis, the constant voltage is 80V. After the indicator enters the separation gel, the voltage is adjusted to 150V, and the electrophoresis is te...
Embodiment 3
[0049] Embodiment 3: 3L tank fermentation of genetically engineered bacterial strains
[0050] Pick a single colony from the plate and inoculate it in YPD medium at 30°C, cultivate it at 220rpm for 24h, and inoculate it in 800mL batch fermentation medium (85% phosphoric acid 26.7mL / L, CaSO 4 0.93g / L,K 2 SO 4 18.2g / L, MgSO 4 ·7H 2 O 14.9g / L, KOH 4.13g / L, glycerol 40.0g / L, PTM 1 4.35mL / L) in the 3L fermenter (NBS company of the United States), the initial stirring speed is 500-550r / min, the air flow is 1.5-2vvm, 50% ammoniacal liquor and 30% phosphoric acid control pH5.5, and the culture temperature in the growth period is 28-30°C, when glycerin runs out of dissolved oxygen and rebounds, add 50% in exponential feeding mode (w / v contains 12mL / L PTM 1 )glycerin. The flow acceleration rate is calculated as follows: (t) is the flow acceleration rate (L / h), X 0 is the cell density (g / L), V 0 is the initial volume (L), S f Represents the concentration of glycerol in the ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More