Cotton ascorbic acid peroxidase gene APX and application thereof

A technology of peroxidase and ascorbic acid, applied in the fields of plant molecular biology and genetic engineering, can solve the problems of limited research on the function of APX gene

Pending Publication Date: 2017-05-31
HEBEI AGRICULTURAL UNIV.
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] So far, the research on the function of APX gene in cotton is still very limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cotton ascorbic acid peroxidase gene APX and application thereof
  • Cotton ascorbic acid peroxidase gene APX and application thereof
  • Cotton ascorbic acid peroxidase gene APX and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Cloning and expression pattern analysis of cotton ascorbate peroxidase gene APX gene

[0036] 1. Planting of cotton seedlings: develvet the seeds of sea island cotton Pima 90-53, Zhongmiansuo No. 8 and Nongda 601 with concentrated sulfuric acid, soak them in water to absorb water to accelerate germination, and transfer them to vermiculite soaked in nutrient solution after the roots grow to 1 cm. After one week of growth, the cotyledons of the plants were unfolded, and the plants with the same growth were selected respectively, and three plants were used as a group, and three biological replicates were taken. The roots, stems, and leaves were sampled separately, and frozen in liquid nitrogen. In an RNase-free environment, use a high-temperature and high-pressure sterilized mortar and pestle to fully grind, store in an ultra-low temperature refrigerator, and set aside.

[0037] 2. Extraction and reverse transcription of total RNA. Use the EasySpin Plant RNA Extr...

Embodiment 2

[0062] Example 2 Using VIGS technology to negatively verify APX gene function

[0063] 1. Construction of VIGS vector PYL156-APX

[0064] Select the enzyme cutting sites Xba I and BamH I, and carry out double enzyme digestion on the pYL156 vector plasmid and the pMD19-APX intermediate recombinant plasmid. The enzyme digestion reaction is: 10×Fast Buffer 2 μL, plasmid DNA 1 μg, Xba I 1 μL, BamH I 1 μL , ddH 2 O to make up to 20 μL. The digested products were ligated and transformed into Escherichia coli, positive clones were detected by PCR and plasmid digestion, and sent for sequencing. The bacterial liquid determined by sequencing was shaken, and the plasmid was extracted and transformed into Agrobacterium GV3101.

[0065] 2. Cotton seedling planting and bacterial injection

[0066] (1) Wash the Nongda 601 cotton seeds, add water and place them on a horizontal shaker, wait for germination, and change the water frequently during the period.

[0067] (2) Scatter the lubai ...

Embodiment 3

[0079] Example 3 Positive verification of the function of APX gene transformed tobacco

[0080] 1. Construction of eukaryotic expression vector

[0081] Select the restriction sites of the overexpression vector PC6 as BamH I and Kpn I and use Primer 5.0 to design primers (Tm: 58°C) as follows:

[0082] F(5'-3'): GGATCCATGACCAAGTGTTACCC

[0083] R(5'-3'): GGTACCTTATGCATCAGCAAATCC

[0084] Carry out PCR amplification, PCR reaction system: 2×Phanta Master mix 25 μL, primer F (10U / μL) 2 μL, primer R (10U / μL) 2 μL, APX plasmid 5 μL, ddH 2 O to make up to 50 μL. The PCR reaction program was 94°C for 5min, 94°C for 30s, 54°C for 30s, 72°C for 1min, a total of 35 cycles, 72°C for 10min, and 4°C for incubation.

[0085] The PCR product gel was recovered and transformed into Escherichia coli and sent for sequencing, and the correct sequence was extracted from the plasmid, and then the target gene plasmid with the restriction site and the empty vector plasmid were digested and ligate...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a cotton ascorbic acid peroxidase gene APX and application thereof, and belongs to the technical field of gene engineering. A nucleotide sequence of the gene APX is shown in SEQ ID NO.1 or shown in a sequence which has 80% of homology with the sequence. The cloned gene APX has the advantages that the expression is different after the gene APX is induced by verticillium dahliae in different corn varieties; the up-regulated expression is presented in the anti-disease variety in the whole tendency, and the down-regulated expression is presented in the disease-susceptible land cotton variety, namely that the expression is inhibited; a VIGS (virus induced gene silencing) carrier PYL156-APX is built, the gene APX in cotton is silenced, and the resistance reaction of the gene APX on the verticillium dahliae of the cotton is reversely demonstrated; the gene is converted into tobacco, and the resistance reaction of the gene APX on the verticillium dahliae of the cotton is positively demonstrated; the gene APX is used for improving the resistance of the crop on the verticillium dahliae, and the broad application prospect is realized in the crop germplasm resources improving and genetic breeding aspects.

Description

technical field [0001] The invention belongs to the technical fields of plant molecular biology and genetic engineering, and in particular relates to a cotton ascorbate peroxidase gene APX and its application in improving plant resistance to Verticillium dahliae. Background technique [0002] Verticillium wilt of cotton is highly contagious and can spread worldwide. Verticillium wilt has gradually spread in my country since the introduction of the American Sizi cotton seed in 1935. The pathogen exists in the soil for several years in the form of microsclerotia, and once the conditions are suitable, it will break out again, so it is difficult to cure. In the 1990s, the disease broke out on a large scale in my country's major cotton regions, including Xinjiang. According to incomplete statistics, the annual incidence area is about 3 million hm 2 , my country's annual direct economic losses due to verticillium wilt can reach about 2 billion yuan. Verticillium dahliae is the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/53C12N9/08C12N15/82C12N15/11A01H5/00
Inventor 吴金华刘娜杨君张艳王国宁李志坤柯会锋王省芬吴立强张桂寅马峙英
Owner HEBEI AGRICULTURAL UNIV.
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap