Kit and method for rapidly detecting pseudorabies virus
A pseudorabies virus and detection method technology, which is applied to a kit for rapid detection of pseudorabies virus and its detection field, can solve problems such as non-compliance with environmental protection requirements, secondary pollution or threat, increase detection cost, etc., so as to save detection cost and Time, reduced sampling cost and transportation cost, convenient and fast detection effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Embodiment 1: the detection method of the kit of above-mentioned rapid detection pig, cattle, sheep, dog etc. pseudorabies virus, comprises steps:
[0032] (1) When sampling, choose a cotton swab of appropriate size, penetrate it into the nasal cavity of pigs, cattle, sheep, dogs, etc., and rotate it for a circle, and then take it out;
[0033] (2) After cutting off the long handle, put the cotton swab head into the EP tube, add an appropriate amount of virus preservation solution, and cover the EP tube cap to store at room temperature or store at 4°C, which is the nasal cavity test sample;
[0034] (3) According to the operation manual of Trans Direct Animal Tissue PCR Kit of Beijing Quanshijin Biotechnology Co., Ltd., conduct the nucleic acid extraction test of the nasal test sub-sample, the steps are as follows:
[0035] A: Add 10μl AD2 Buffer to 40μl AD1 Buffer, and pipette evenly with a pipette tip (if you need to extract too much sample, you can mix AD1 and AD2 at...
Embodiment 2
[0046] Embodiment 2: Cloning and amplification of pseudorabies virus gene
[0047] (1) Target gene selection
[0048] In the experiment, a conservative sequence on the full length of the conserved gB gene on the pseudorabies virus genome was selected as the target gene, and the size of the target gene was selected to be about 1300bp.
[0049] (2) Primer design
[0050] F: ATGGCGGCCGTGACGCGGGCCGCCTCGGCCT;
[0051] R: CTAGCTCCACCTGCTGGAAGCGCCCGGG;
[0052] Synthesized by Shanghai Jierui Biological Engineering Co., Ltd.
[0053] (3) PCR template
[0054] The genome of the SA strain of porcine pseudorabies virus was selected as the positive template; the genome was extracted from the disease material for the sample template.
[0055] (4) PCR system
[0056] Premix TaqTM (LA TaqTM Version 2.0) 5ul;
[0057] Forward Premier 0.5ul;
[0058] Reserve Premier 0.5ul;
[0059] Template 1ul;
[0060] ddH2O 3ul.
[0061] (5) PCR program
[0062] 96°C for 5 minutes;
[0063] ; ...
Embodiment 3
[0068] Embodiment 3: the kit assembly of rapid detection pseudorabies virus such as pig, cattle, sheep, dog
[0069] Kit assembly: Cotton swab, EP tube, virus preservation solution, AD1 Buffer, AD2 Buffer, AD3 Buffer, Premix TaqTM (LA TaqTM Version 2.0), PCR primers, sterilized double distilled water, PCR reaction tube, negative control and Positive control, agarose, 50×TAE nucleic acid electrophoresis buffer, and operating instructions are assembled into the kit.
[0070] Note: The kit should be stored at 4°C; Premix TaqTM (LA TaqTM Version 2.0) should be stored at -20°C; 50×TAE should be diluted to 1×TAE with distilled water before use.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com