Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit and method for rapidly detecting pseudorabies virus

A pseudorabies virus and detection method technology, which is applied to a kit for rapid detection of pseudorabies virus and its detection field, can solve problems such as non-compliance with environmental protection requirements, secondary pollution or threat, increase detection cost, etc., so as to save detection cost and Time, reduced sampling cost and transportation cost, convenient and fast detection effect

Pending Publication Date: 2017-05-31
SHANDONG BINZHOU ANIMAL SCI & VETERINARY MEDICINE ACADEMY
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The whole process is not only time-consuming and labor-intensive, but also the collected disease tissue or blood samples need to be cryogenically frozen or refrigerated, which increases transportation costs and does not meet environmental protection requirements; It is easy to cause secondary pollution or threat to experimenters and the environment, which is not conducive to biological safety requirements
If it is to purchase a kit for nucleic acid extraction, it will increase the cost of detection, and the operation process requires the experimenter to have a high level of professional skills and professional quality, which is not easy for first-line farms or grassroots laboratories.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit and method for rapidly detecting pseudorabies virus
  • Kit and method for rapidly detecting pseudorabies virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1: the detection method of the kit of above-mentioned rapid detection pig, cattle, sheep, dog etc. pseudorabies virus, comprises steps:

[0032] (1) When sampling, choose a cotton swab of appropriate size, penetrate it into the nasal cavity of pigs, cattle, sheep, dogs, etc., and rotate it for a circle, and then take it out;

[0033] (2) After cutting off the long handle, put the cotton swab head into the EP tube, add an appropriate amount of virus preservation solution, and cover the EP tube cap to store at room temperature or store at 4°C, which is the nasal cavity test sample;

[0034] (3) According to the operation manual of Trans Direct Animal Tissue PCR Kit of Beijing Quanshijin Biotechnology Co., Ltd., conduct the nucleic acid extraction test of the nasal test sub-sample, the steps are as follows:

[0035] A: Add 10μl AD2 Buffer to 40μl AD1 Buffer, and pipette evenly with a pipette tip (if you need to extract too much sample, you can mix AD1 and AD2 at...

Embodiment 2

[0046] Embodiment 2: Cloning and amplification of pseudorabies virus gene

[0047] (1) Target gene selection

[0048] In the experiment, a conservative sequence on the full length of the conserved gB gene on the pseudorabies virus genome was selected as the target gene, and the size of the target gene was selected to be about 1300bp.

[0049] (2) Primer design

[0050] F: ATGGCGGCCGTGACGCGGGCCGCCTCGGCCT;

[0051] R: CTAGCTCCACCTGCTGGAAGCGCCCGGG;

[0052] Synthesized by Shanghai Jierui Biological Engineering Co., Ltd.

[0053] (3) PCR template

[0054] The genome of the SA strain of porcine pseudorabies virus was selected as the positive template; the genome was extracted from the disease material for the sample template.

[0055] (4) PCR system

[0056] Premix TaqTM (LA TaqTM Version 2.0) 5ul;

[0057] Forward Premier 0.5ul;

[0058] Reserve Premier 0.5ul;

[0059] Template 1ul;

[0060] ddH2O 3ul.

[0061] (5) PCR program

[0062] 96°C for 5 minutes;

[0063] ; ...

Embodiment 3

[0068] Embodiment 3: the kit assembly of rapid detection pseudorabies virus such as pig, cattle, sheep, dog

[0069] Kit assembly: Cotton swab, EP tube, virus preservation solution, AD1 Buffer, AD2 Buffer, AD3 Buffer, Premix TaqTM (LA TaqTM Version 2.0), PCR primers, sterilized double distilled water, PCR reaction tube, negative control and Positive control, agarose, 50×TAE nucleic acid electrophoresis buffer, and operating instructions are assembled into the kit.

[0070] Note: The kit should be stored at 4°C; Premix TaqTM (LA TaqTM Version 2.0) should be stored at -20°C; 50×TAE should be diluted to 1×TAE with distilled water before use.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of pathogenic microorganism detection, and in particular discloses a kit and a method for rapidly detecting pseudorabies virus. The kit for rapidly detecting the pseudorabies virus is characterized by comprising cotton swabs, an EP tube, a virus preservation solution, a virus extracting solution I, a virus extracting solution II, a polymerase chain reaction (PCR) mix, a PCR primer, sterilized double-distilled water, a PCR reaction tube, a negative control and a positive control, agarose, 50*TAE nucleic acid electrophoresis buffer solution and an operating manual. The kit and the method are convenient and rapid in detection, time-saving, labor-saving and easy to learn, protect the bio-safety of experimenters and environment to the utmost extent, reduce the sampling cost and the transportation cost, and meet the requirements of environmental protection, thus being easily popularized and used in general laboratories.

Description

[0001] (1) Technical field [0002] The invention relates to the technical field of pathogenic microorganism detection, in particular to a kit for rapidly detecting pseudorabies virus and a detection method thereof. [0003] (2) Background technology [0004] At present, the traditional method of detecting pseudorabies virus is to collect the tissues of sick animals, grind them with a tissue homogenizer, centrifuge at a high speed, and then extract the viral nucleic acid DNA from the centrifuged supernatant, or directly collect blood samples from sick animals After the pathological examination, the nucleic acid and DNA were extracted, and finally the PCR reaction and electrophoresis detection were carried out. The whole process is not only time-consuming and labor-intensive, but also the collected disease tissue or blood samples need to be cryogenically frozen or refrigerated, which increases transportation costs and does not meet environmental protection requirements; It is e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
CPCC12Q1/686C12Q1/705C12Q2531/113C12Q2565/125
Inventor 郭广君吕素芳韩强刘吉山李峰沈志强
Owner SHANDONG BINZHOU ANIMAL SCI & VETERINARY MEDICINE ACADEMY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com