Primer for simultaneously detecting diversified respiratory viruses on basis of melting curve processes and single tube and application of primer
A melting curve and respiratory technology, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problem of detection of multiple pathogens, false negative results of viral antigens, and multiple detection methods. 3-5 and other problems, to achieve the effect of simple operation, high sensitivity and low detection cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0066] Embodiment 1: Simultaneous detection of influenza A virus, influenza B virus, respiratory syncytial virus type A, respiratory syncytial virus type B, rhinovirus, Coxsackie virus type B, adenovirus primers and probe sequences, by Synthesis of Yingwei Jieji (Shanghai) Trading Co., Ltd.:
[0067] Reverse transcription primers for reverse transcription:
[0068] Numbering Primer name Sequence (5'-3') corresponding virus SEQ ID NO.1 IFA-rtp GGGCACGGTGAGCGTGAA Influenza A virus SEQ ID NO.2 IFB-rtp GTTTTCRTATCCTCCKGAGAAG Influenza B virus SEQ ID NO.3 RSVA-rtp GGTATGTTGGGGTTGTGTT Respiratory syncytial virus type A SEQ ID NO.4 RSVB-rtp TTTCAGTGTGGYTTTYTATTGTT Respiratory syncytial virus type B SEQ ID NO.5 RVA-rtp TTGTGTGCACTGGCTGCAGG rhinovirus type A SEQ ID NO.6 RVB-rtp TTATGCTGCAAGGCTCTGGG rhinovirus type B SEQ ID NO.7 RVC-rtp GTGTGCGATAGCTGCGGG rhinovirus type C SEQ ID NO.8 CoxB...
Embodiment 2
[0078] Embodiment 2: sample nucleic acid extraction
[0079] (1) Collection, storage and transportation of clinical specimens: suitable for collection of throat swab specimens. It is advisable to collect in the early morning. Rinse mouth with clean water, assisted by the examiner with a tongue depressor, pass the throat swab over the base of the tongue, reach the lesion in the pharyngeal isthmus, apply it several times, avoid touching the tongue and oral mucosa when taking it out, and swab the swab after sampling Put the swab into about 1mL of normal saline and wash it thoroughly, then squeeze it dry, and discard the cotton swab. The specimens to be tested should not be stored for more than 24 hours at 4°C, and should not be stored for more than 48 hours at -20°C; and not more than three months at -80°C. Specimens should be transported in curlers or foam boxes with ice.
[0080] (2) Extraction of viral RNA: Extraction of viral RNA was carried out according to the instructio...
Embodiment 3
[0081] Example 3: Reverse transcription using the extracted nucleic acid as a template
[0082] (1) Prepare mixed reverse transcription primer working solution:
[0083] Dilute the synthesized reverse transcription primers to 100uM, add 10uL each to a 1.5mL centrifuge tube, add water to 500uL, vortex and mix to obtain the reverse transcription primer working solution.
[0084] (2) Sample viral RNA reverse transcription:
[0085] The total RNA in the sample was reverse-transcribed according to the RevertAid RT Reverse Transcription Kit (Themo, K1691). The reaction system was 10uL, the reverse transcription primer working solution was 0.5ul, other components were added according to the instructions, and finally water was added to 10uL.
[0086] Reaction procedure: 1h at 42°C; 5min at 85°C; store at 4°C.
PUM
| Property | Measurement | Unit |
|---|---|---|
| melting point | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


