Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer for simultaneously detecting diversified respiratory viruses on basis of melting curve processes and single tube and application of primer

A melting curve and respiratory technology, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problem of detection of multiple pathogens, false negative results of viral antigens, and multiple detection methods. 3-5 and other problems, to achieve the effect of simple operation, high sensitivity and low detection cost

Inactive Publication Date: 2017-06-13
HANGZHOU D A GENETIC ENG
View PDF4 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] For the diagnosis of respiratory virus infection, the commonly used detection methods are as follows: 1. Virus isolation and culture method is the "gold standard" for virus diagnosis. Disadvantages: time-consuming and labor-intensive, and require experienced operators; biosafety risk is high
2. Immunological examination is a commonly used method for clinical outpatient examination. This method is simple, fast, and low-cost, but the sensitivity and specificity are not high. When the virus antigen mutates, false negative results occur, and one test can only be used for one of them. pathogen
3. Molecular biology methods, the advantages of which are: high sensitivity and strong specificity, but the common fluorescent PCR detection generally used at present can only detect one virus at a time, and realize the detection of all pathogens by repeating multiple times, while multi-channel fluorescence A single detection tube can only detect 3-5 at most, which cannot meet the detection of multiple pathogens at one time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer for simultaneously detecting diversified respiratory viruses on basis of melting curve processes and single tube and application of primer
  • Primer for simultaneously detecting diversified respiratory viruses on basis of melting curve processes and single tube and application of primer
  • Primer for simultaneously detecting diversified respiratory viruses on basis of melting curve processes and single tube and application of primer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Embodiment 1: Simultaneous detection of influenza A virus, influenza B virus, respiratory syncytial virus type A, respiratory syncytial virus type B, rhinovirus, Coxsackie virus type B, adenovirus primers and probe sequences, by Synthesis of Yingwei Jieji (Shanghai) Trading Co., Ltd.:

[0067] Reverse transcription primers for reverse transcription:

[0068] Numbering Primer name Sequence (5'-3') corresponding virus SEQ ID NO.1 IFA-rtp GGGCACGGTGAGCGTGAA Influenza A virus SEQ ID NO.2 IFB-rtp GTTTTCRTATCCTCCKGAGAAG Influenza B virus SEQ ID NO.3 RSVA-rtp GGTATGTTGGGGTTGTGTT Respiratory syncytial virus type A SEQ ID NO.4 RSVB-rtp TTTCAGTGTGGYTTTYTATTGTT Respiratory syncytial virus type B SEQ ID NO.5 RVA-rtp TTGTGTGCACTGGCTGCAGG rhinovirus type A SEQ ID NO.6 RVB-rtp TTATGCTGCAAGGCTCTGGG rhinovirus type B SEQ ID NO.7 RVC-rtp GTGTGCGATAGCTGCGGG rhinovirus type C SEQ ID NO.8 CoxB...

Embodiment 2

[0078] Embodiment 2: sample nucleic acid extraction

[0079] (1) Collection, storage and transportation of clinical specimens: suitable for collection of throat swab specimens. It is advisable to collect in the early morning. Rinse mouth with clean water, assisted by the examiner with a tongue depressor, pass the throat swab over the base of the tongue, reach the lesion in the pharyngeal isthmus, apply it several times, avoid touching the tongue and oral mucosa when taking it out, and swab the swab after sampling Put the swab into about 1mL of normal saline and wash it thoroughly, then squeeze it dry, and discard the cotton swab. The specimens to be tested should not be stored for more than 24 hours at 4°C, and should not be stored for more than 48 hours at -20°C; and not more than three months at -80°C. Specimens should be transported in curlers or foam boxes with ice.

[0080] (2) Extraction of viral RNA: Extraction of viral RNA was carried out according to the instructio...

Embodiment 3

[0081] Example 3: Reverse transcription using the extracted nucleic acid as a template

[0082] (1) Prepare mixed reverse transcription primer working solution:

[0083] Dilute the synthesized reverse transcription primers to 100uM, add 10uL each to a 1.5mL centrifuge tube, add water to 500uL, vortex and mix to obtain the reverse transcription primer working solution.

[0084] (2) Sample viral RNA reverse transcription:

[0085] The total RNA in the sample was reverse-transcribed according to the RevertAid RT Reverse Transcription Kit (Themo, K1691). The reaction system was 10uL, the reverse transcription primer working solution was 0.5ul, other components were added according to the instructions, and finally water was added to 10uL.

[0086] Reaction procedure: 1h at 42°C; 5min at 85°C; store at 4°C.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
melting pointaaaaaaaaaa
Login to View More

Abstract

The invention discloses a primer for simultaneously detecting diversified respiratory viruses on the basis of melting curve processes and a single tube, and belongs to the field of technologies for detecting nucleic acid. The primer comprises reverse transcription primers shown as SEQ ID NO.1-8, amplification primers shown as SEQ ID NO.9-26, amplification starting universal primers shown as SEQ ID NO.27-28 and molecular beacon probes shown as SEQ ID NO.29-35. Fluorescence groups and quenching groups are arranged at two ends of each molecular beacon probe. The primer has the advantages that the primer is based on Tem-PCR (target enriched multiplex-polymerase chain reaction) technologies and melting curve analysis, gene sequences of the diversified viruses are compared in gene sequence libraries of NCBI (national center for biotechnology information), specific primers and the molecular beacon probes are arranged at conservative sites by means of designing, accordingly, 7 types of respiratory viruses can be simultaneously detected by the single tube, and the primer is easy to operate and convenient to apply.

Description

technical field [0001] The invention relates to the technical field of nucleic acid detection, in particular to a method for simultaneously detecting multiple respiratory viruses based on a fluorescent probe melting curve method, the seven viruses include: influenza A virus (IFA), influenza B virus (IFB), Respiratory syncytial virus type A (RSVA), respiratory syncytial virus type B (RSVB), rhinovirus (RV), coxsackievirus type B (CoxB), adenovirus (AdV). Background technique [0002] Acute respiratory infection is one of the most common clinical diseases, which can occur in any gender, age and region, especially in the elderly and infants with high morbidity and mortality, which seriously affects people's health and brings social impact. to serious economic losses. In the 20th century alone, more than 100 million people worldwide died of influenza virus infection. Acute respiratory tract infection can be caused by bacteria, virus and mycoplasma infection, among which respir...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
CPCC12Q1/686C12Q1/701C12Q2600/16C12Q2563/107C12Q2527/107C12Q2537/143
Inventor 任绪义张锋罗英金亚南
Owner HANGZHOU D A GENETIC ENG
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com