Recombinant pichia pastoris for enhanced expression of xylanase from Streptomyces sp.FA1

A technology of Pichia pastoris and xylanase, applied in the field of genetic engineering, can solve the problems such as episomal expression plasmids that have not yet been seen, and achieve the effect of improving specific activity

Active Publication Date: 2017-09-08
JIANGNAN UNIV
View PDF1 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, in the expression system of Pichia pastoris, the integrated recombinant strains are constructed for recombinant expression of foreign genes, and no episomal expression plasmids have been used for expression.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant pichia pastoris for enhanced expression of xylanase from Streptomyces sp.FA1
  • Recombinant pichia pastoris for enhanced expression of xylanase from Streptomyces sp.FA1
  • Recombinant pichia pastoris for enhanced expression of xylanase from Streptomyces sp.FA1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: Construction of expression vector pGAPZαA-PARS

[0035] The self-replicating sequence PARS with nucleotide sequence as shown in SEQ ID NO.2 was synthesized by whole gene synthesis technology; the recovered PARS gene fragment was connected with plasmid pGAPZαA by infusion enzyme to construct the expression vector pGAPZαA-PARS.

Embodiment 2

[0036] Example 2: Production of Pichia pastoris KM71 / pPIC9K-XynA Competent Cells:

[0037]1) Pick a single colony of yeast KM71 / pPIC9K-XynA, inoculate it into a 50ml Erlenmeyer flask containing 10ml of YPD medium, and culture overnight at 30°C and 250rpm;

[0038] 2) Inoculate 100 μL of cultured cells into a 500ml Erlenmeyer flask containing 100mL of LYPD medium, culture overnight at 30°C and 250rpm until OD600 reaches 1.3-1.5;

[0039] 3) Centrifuge three 50ml sterile centrifuge tubes at 4°C, 5000rpm for 5min, discard the supernatant, add 4ml sterile water to each tube to fully suspend the cells, collect and combine them into one tube; add 2ml 10*TE buffer solution (PH=7.5), 2ml 10 *LiAC and 0.5ml 1M DTT were rotatably mixed, and shaken in a water bath at 30°C and 50rpm for 45min.

[0040] 4) Dilute the bacterial suspension in 3) with sterile water to 30ml, centrifuge at 5000rpm at 4°C for 5min, discard the supernatant to collect the bacterial cells, and add 25mL of pre-cool...

Embodiment 3

[0044] Example 3: Construction of Enhanced Expression Recombinant Bacteria KM71 / pPIC9K-XynA / pGAPZαA-PARS-XynA

[0045] Construction of recombinant plasmid pGAPZαA-PARS-XynA:

[0046] The plasmid pMD18-T-XynA (A xylanase from Streptomyces sp.FA1: heterologous expression, characterization, and its application in Chinese steamed bread, YangXu, Journal of Industrial Microbiology & Biotechnology, May 2016, Volume43, Issue5, pp 663-670) was used as the template A forward primer with the sequence shown in SEQ ID NO.3: CCGGAATTCATGGCCGAGAACACCCTT and a reverse primer with the sequence shown in SEQ ID NO.4: ATTTGCGGCCGCTCAGGTGCGGGTCCAGCGTT were designed. The XynA fragment with Not I and EcoR I restriction sites was obtained by polymerase chain reaction.

[0047] PCR reaction system (50μL):

[0048]

[0049] PCR program: 94°C, 4min (pre-denaturation); 98°C, 10s (denaturation); 60°C, 5s (annealing); 72°C, 90s (extension); set 30 cycles; set after 72°C, 10min (insulation) The storag...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Belonging to the field of genetic engineering, the invention discloses a recombinant pichia pastoris for enhanced expression of xylanase from Streptomyces sp.FA1. According to the invention, a target gene with a nucleotide sequence shown as SEQ ID NO:1 is acquired by amplification, the target gene is connected to the expression vector pGAPZ alpha A-PARS, and then the obtained recombinant vector is introduced into pichia pastoris KM71 / pPIC9K-XynA so as to obtain the recombinant pichia pastoris. The invention also discloses a production method for the recombinant engineered pichia pastoris. The method includes the steps of: (1) synthesizing an autonomously replicating sequence PARS by whole gene synthesis technology; (2) constructing the expression vector pGAPZ alpha A-PARS; (3) constructing the recombinant expression vector pGAPZ alpha A-PARS-XynA; (4) converting a pichia pastoris host and screening a positive transformant; (5) conducting flask shaking induction culture; and (6) inducing recombinant engineered pichia pastoris in a fermentation tank to produce xylanase.

Description

technical field [0001] The invention relates to a Pichia pastoris recombinant bacterium for strengthening the expression of xylanase derived from Streptomyces sp.FA1, which belongs to the field of genetic engineering. Background technique [0002] Xylanase belongs to glycoside hydrolase [EC 3.2.1.x]. According to the different action sites, this type of enzyme can be divided into two types: one is to act on the main chain skeleton of xylan, mainly endo β-1,4-D-xylanase and β-xylosidase, the former acts on the β-1,4-D-glycosidic bond in the middle of xylan, and the latter acts on the terminal decomposition of xylooligosaccharides Xylose monosaccharide is formed, and under the joint participation of these two enzymes, the degradation of xylan is realized. The second class is enzymes acting on branched chain substituents, including α-L-arabinofuranosidase [EC 3.2.1.55], α-D-glucuronidase [EC 3.2.1.139], acetylxylan Esterase [EC 3.2.1.72], p-coumaric acid esterase [EC 3.1.1], ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/19C12N9/24C12N15/56C12N15/81C12R1/84
Inventor吴敬吴丹潘阳
OwnerJIANGNAN UNIV