Method for cultivating heterodera glycines resisting transgenic plants
A technology for soybean cyst nematodes and transgenic plants, which is applied in the field of plant genetic engineering and can solve the problems of technical data on soybean cyst nematode-resistant transgenic plants that have not yet been seen.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Example 1. Discovery of soybean cyst nematode Hg-cpn-1 gene fragment and soybean root-specific promoter
[0044] Using the nematode genome database (Nematode.net) and soybean cyst nematode ESTs database information, it was found that the soybean cyst nematode gene Hg-cpn-1 has a conserved sequence. In this conserved region, a fragment with a sequence length of 418 bp was finally determined, as shown in SEQ-1. The RNA encoded by the fragment shown in SEQ-1 is expected to inhibit cyst nematodes.
[0045] Utilizing Phytozome database (https: / / phytozome.jgi.doe.gov / pz / portal.html) and soybean public database (http: / / soybase.org / ), according to the upstream sequence of soybean root-specific expression gene Glyma.11G236700.1 Design specific primers GmP-F1 / GmP-R1. Using the genomic DNA of soybean cultivar Williams82 as a template, KOD FX high-fidelity enzyme (TOYOBO, Japan) was used for PCR amplification. The PCR reaction conditions were: 95°C for 5min; cycle; 72°C for 10mi...
Embodiment 2
[0048] Embodiment 2. Construction of RNAi recombinant plasmid
[0049] (1) Using the double-stranded DNA molecule shown in SEQ-2 as a template, GmP-F2-attB5r and GmP-R2 are used to form a primer pair, and KOD FX high-fidelity enzyme is used for PCR amplification to obtain PCR amplification products.
[0050] GmP-F2-attB5r: 5'-CGAGCTCggggacaactttgtatacaaaagttgttGAATCAAAGCTTATCAACTAGTTAG-3'
[0051] GmP-R2: 5'-CCGCTCGAGCCCAATGGAAGACATGTTATTCTCTGCAAAAC-3'
[0052] In the primer pair of GmP-F2-attB5r and GmP-R2, the restriction endonuclease recognition sequence is underlined, wherein, "GAGCTC" is the restriction endonuclease Sac I restriction endonuclease recognition sequence. "CTCGAG" is the recognition sequence for restriction endonuclease Xho I, and "ggggacaactttgtatacaaaagttgtt" is the recombination site attB5r.
[0053] The PCR reaction conditions were: 95°C for 2min; (94°C for 30s, 56°C for 45s, 72°C for 2min), a total of 35 cycles; 72°C for 10min. The purified PCR amplif...
Embodiment 3
[0072] Example 3. Acquisition and Identification of Transgenic Plants Resistant to Soybean Cyst Nematode
[0073] 1. Agrobacterium-mediated soybean genetic transformation
[0074] (1) The recombinant plasmid pCAMBIA3301-cpn1 RNAi was introduced into Agrobacterium EHA105 by freeze-thaw method to obtain recombinant Agrobacterium.
[0075] (2) Resuspend Agrobacterium with the CCM liquid medium in the attached table 1 to obtain a bacterial suspension with OD600nm=0.5-0.8 for future use.
[0076] (3) Select cultivated soybean Williams82 seeds and sterilize them in a closed container containing chlorine for 12-16 hours.
[0077] (4) Take the sterilized seeds in step (3), put them on a GM medium plate with the hilum facing down, and culture them in dark at 23° C. for 24 hours.
[0078] (5) Cut along the hilum with a sterile scalpel, remove the axillary buds, slightly scratch the cotyledon nodes above the axillary buds, and then soak in the bacterial suspension obtained in step (2) ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


