Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for cultivating heterodera glycines resisting transgenic plants

A technology for soybean cyst nematodes and transgenic plants, which is applied in the field of plant genetic engineering and can solve the problems of technical data on soybean cyst nematode-resistant transgenic plants that have not yet been seen.

Pending Publication Date: 2017-10-17
JILIN ACAD OF AGRI SCI
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] At present, the research on RNAi-mediated H.glycines gene silencing is mainly focused on the verification of gene function, and there is no technical information on the use of cyst nematode Hg-snb1 gene fragments to breed soybean cyst nematode-resistant transgenic plants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for cultivating heterodera glycines resisting transgenic plants
  • Method for cultivating heterodera glycines resisting transgenic plants
  • Method for cultivating heterodera glycines resisting transgenic plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1. Discovery of soybean cyst nematode Hg-cpn-1 gene fragment and soybean root-specific promoter

[0044] Using the nematode genome database (Nematode.net) and soybean cyst nematode ESTs database information, it was found that the soybean cyst nematode gene Hg-cpn-1 has a conserved sequence. In this conserved region, a fragment with a sequence length of 418 bp was finally determined, as shown in SEQ-1. The RNA encoded by the fragment shown in SEQ-1 is expected to inhibit cyst nematodes.

[0045] Utilizing Phytozome database (https: / / phytozome.jgi.doe.gov / pz / portal.html) and soybean public database (http: / / soybase.org / ), according to the upstream sequence of soybean root-specific expression gene Glyma.11G236700.1 Design specific primers GmP-F1 / GmP-R1. Using the genomic DNA of soybean cultivar Williams82 as a template, KOD FX high-fidelity enzyme (TOYOBO, Japan) was used for PCR amplification. The PCR reaction conditions were: 95°C for 5min; cycle; 72°C for 10mi...

Embodiment 2

[0048] Embodiment 2. Construction of RNAi recombinant plasmid

[0049] (1) Using the double-stranded DNA molecule shown in SEQ-2 as a template, GmP-F2-attB5r and GmP-R2 are used to form a primer pair, and KOD FX high-fidelity enzyme is used for PCR amplification to obtain PCR amplification products.

[0050] GmP-F2-attB5r: 5'-CGAGCTCggggacaactttgtatacaaaagttgttGAATCAAAGCTTATCAACTAGTTAG-3'

[0051] GmP-R2: 5'-CCGCTCGAGCCCAATGGAAGACATGTTATTCTCTGCAAAAC-3'

[0052] In the primer pair of GmP-F2-attB5r and GmP-R2, the restriction endonuclease recognition sequence is underlined, wherein, "GAGCTC" is the restriction endonuclease Sac I restriction endonuclease recognition sequence. "CTCGAG" is the recognition sequence for restriction endonuclease Xho I, and "ggggacaactttgtatacaaaagttgtt" is the recombination site attB5r.

[0053] The PCR reaction conditions were: 95°C for 2min; (94°C for 30s, 56°C for 45s, 72°C for 2min), a total of 35 cycles; 72°C for 10min. The purified PCR amplif...

Embodiment 3

[0072] Example 3. Acquisition and Identification of Transgenic Plants Resistant to Soybean Cyst Nematode

[0073] 1. Agrobacterium-mediated soybean genetic transformation

[0074] (1) The recombinant plasmid pCAMBIA3301-cpn1 RNAi was introduced into Agrobacterium EHA105 by freeze-thaw method to obtain recombinant Agrobacterium.

[0075] (2) Resuspend Agrobacterium with the CCM liquid medium in the attached table 1 to obtain a bacterial suspension with OD600nm=0.5-0.8 for future use.

[0076] (3) Select cultivated soybean Williams82 seeds and sterilize them in a closed container containing chlorine for 12-16 hours.

[0077] (4) Take the sterilized seeds in step (3), put them on a GM medium plate with the hilum facing down, and culture them in dark at 23° C. for 24 hours.

[0078] (5) Cut along the hilum with a sterile scalpel, remove the axillary buds, slightly scratch the cotyledon nodes above the axillary buds, and then soak in the bacterial suspension obtained in step (2) ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for cultivating heterodera glycines resisting transgenic plants. The method comprises the following steps: guiding DNA fragments and a root-specific promoter to a target plant in a combined manner; and enabling the DNA fragments to be mainly and specifically expressed in the root of the target plant to obtain the transgenic plant with remarkably improved heterodera glycines resistance. The method has high application value on cultivation of heterodera glycines resisting plants (particularly soybeans).

Description

technical field [0001] The invention relates to the technical field of plant genetic engineering, in particular to a method for cultivating soybean cyst nematode-resistant transgenic plants. Background technique [0002] Soybean cyst nematode (SCN) is a worldwide soybean disease caused by soybean cyst nematode (Heteroderaglycines lchinohe), which is widely distributed in major soybean producing countries in the world, such as the United States, Brazil, Argentina, and China. . According to statistics, SCN can reduce soybean production by 7% to 10% every year, and in severe cases, it can reach 15-50%, or even stop production, causing economic losses of about 1 billion to 1.5 billion U.S. dollars every year. SCN occurs in Northeast my country and the main soybean producing areas of Huanghuaihai, especially in the saline-alkali land, white pulp soil and sandy soil in Heilongjiang Province, central and western Jilin Province, and Inner Mongolia, with an annual damage area of ​​2...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82A01H5/00
CPCC12N15/8227C12N15/8285
Inventor 杨向东董英山牛陆张金花杨静邢国杰贺红利郭东全钱雪燕姚瑶
Owner JILIN ACAD OF AGRI SCI