A kind of nano influenza vaccine and its construction method and application
A recombinant protein, 3m2e-rhf technology, applied in chemical instruments and methods, biochemical equipment and methods, pharmaceutical formulations, etc., can solve problems such as difficult to produce vaccines in time, simplify the vaccine preparation process, improve immunogenicity, Safe and convenient to use
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] The preparation method of 3M2e-rHF nano flu vaccine, its steps are:
[0037] (1) Construct the 3M2e-rHF protein expression plasmid pET28a / 3M2e-rHF:
[0038] PCR amplification of rHF sequence: using the plasmid pET-rHF encoding human ferritin H chain sequence (rHF) (gifted by Dr PaoloSantambrogio (Milan, Italy)) as a template (Nanoscale, 2012, 4, 188), sense primer: 5'CCGGTGTAATGGAAGCTCCGACGGAGGAGGAGGATCTATGACGACCGCGTCCACCTC 3 ', reverse primer: 5' CCGCTCGAGTTAGCTTTTCATTATCACTGTC 3';
[0039] 3M2e sequence: The nucleic acid sequence of M2e (Gene ID: 956528) was found in NCBI, and the 3M2e sequence was chemically synthesized. Using the synthetic 3M2e nucleic acid sequence as a template, the sense primer: 5'GGGAATTCCATATGATGTCTCTGCTGACCGAGG3', the reverse primer: 5'GAGGTGGACGCGGTCGTCATAGATCCTCCTCCTCCGTCGGAGCTTCCATTACACC3', the M2e amino acid sequence is MSLLTEVETPIRNEWGCRCNGSSD, consistent with the sequence of the M2e influenza virus in A / Puerto Rico / 8 / 34 (H1N1).
[0040...
Embodiment 2
[0044] The verification of the immune effect of 3M2e-rHF nanoparticle influenza vaccine in mice, the steps are as follows:
[0045] (1) Balb / c mice aged 6 to 8 weeks were randomly divided into groups, and 10 μg of 3M2e-rHF nanoparticles, 2.6 μg of 3M2e synthetic peptides (compared with 3M2e-rHF nanoparticles containing equimolar M2e), Balb / c mice were immunized with 6.3 μg of rHF nanoparticles (compared with 3M2e-rHF nanoparticles containing equimolar rHF) and PBS via intranasal route for three times, with an interval of three days between two adjacent immunizations. week. Mouse serum was collected two weeks after each immunization, stored at -20°C, and ELISA was used to detect M2e-specific antibodies. Antibody detection results showed that after three immunizations, the 3M2e polypeptide and rHF nanoparticles immunized mice were the same as the PBS control mice, and M2e-specific IgG antibodies were not detected in the serum, while 3M2e-rHF nanoparticles induced a large amount...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap