OsbHLH116 gene for controlling rice seed germination, RNAi carrier, as well as preparation method and application thereof

An osbhlh116 and rice seed technology, applied in the field of plant genetic engineering, can solve the problems of high cost, cumbersome operation, long test period and the like, and achieve the effects of high cost efficiency, simple operation and low cost

Active Publication Date: 2017-11-28
HENAN AGRICULTURAL UNIVERSITY
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional RNAi vector construction usually adopts enzyme-cut ligation and multi-step cloning to connect sense RNA and antisense RNA respectively to form dsRNA (Liu Lei et al., 2015). LR reaction) can construct the target fragment into the expression vector, which has the characteristics of high efficiency and rapidity, but its versatility is poor and the cost is high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • OsbHLH116 gene for controlling rice seed germination, RNAi carrier, as well as preparation method and application thereof
  • OsbHLH116 gene for controlling rice seed germination, RNAi carrier, as well as preparation method and application thereof
  • OsbHLH116 gene for controlling rice seed germination, RNAi carrier, as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Design and Synthesis of OsbHLH116 Interfering Fragments

[0040] According to the principle of simple RNAi technology (Higuchi et al., 2009; Liu Yanxia et al., 2014), a 60bp sequence (5′-ATCGGAGGAAGAGATGGCAGCGTGGCTCTATCCGATCGTCAGTGGCCACGAAGTCGCCGG-3′, such as SEQ ID NO. 3) as a small interference fragment (positive primer OsbHLH116-F), it was compared in the rice genome database (http: / / rapdb.dna.affrc.go.jp / ), and no homologous sequence was found. The 9 bases at the 3' end (5'-AGTCGCCGG-3') and the reverse complement (5'-CCGGCGACT-3') were used as the 9 bases at the 3' end of the reverse primer (OsbHLH116-R), and the remaining 51 bases base as the 5'-end sequence of the reverse primer (e.g. figure 1 A), the primer sequence for synthesizing the RNA interference fragment of OsbHLH116 gene: siRNA-F: 5′-gtac GGTACC ATCGGAGGAAGAGATGGCAGCGTGGCTCTA TCCGATCGTC AGTGGCCACG AAGTCGCCGG-3' (as shown in SEQ ID NO. 4); siRNA-R: 5'-tcga GAGCTC ATCGGAGGAA GAGATGGCAG CGTGGCTCTA T...

Embodiment 2

[0043] Construction of OsbHLH116-RNAi expression vector

[0044] Use restriction enzymes KpnI and SacI to digest pTCK303 plasmid and OsbHLH116 small interference fragment respectively. The 50 μL digestion system is as follows: pTCK303 plasmid 2 μg (OsbHLH116 small interference fragment 1 μg), 10×L Buffer 5 μL, KpnI10U, SacI 10U, add ddH 2 O to 50μL, digested at 37°C for 4h. The digested products were purified and added to the following ligation system: 4 μL of linear plasmid, 4 μL of small interference fragment, 1 μL of 10×Buffer, 1 μL of T4 DNA ligase, and ligated overnight at 4°C. The ligation product was transformed into Escherichia coli DH5α competent cells by heat shock method, and the bacterial solution was coated on a flat plate containing 50 mg / L kanamycin, and after overnight culture, a monoclonal shaking bacterium was selected for propagation, and primer pTCK303-VF (such as SEQ ID NO. 6) and pTCK303-VR (shown in SEQ ID NO. 7) for colony PCR validation. The size of ...

Embodiment 3

[0046] Application of RNAi vectors in rice breeding.

[0047] Agrobacterium-mediated transformation of rice callus and detection of positive transgenic plants

[0048] The OsbHLH116-RNAi expression vector was transformed into Agrobacterium EHA105, followed by Nishimura et al. (Nishimura et al., 2007) to infect the mature embryo callus of rice Xinfeng 2, and screened for hygromycin (Hyg) resistance to obtain regenerated seedlings. GUS staining was used to screen positive plants, and T 2 Generation of transgenic positive plants (OsbHLH116-RNAi-1, OsbHLH116-RNAi-2, OsbHLH116-RNAi-3 lines) were used for subsequent experiments.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an OsbHLH116 gene for controlling rice seed germination, an RNAi carrier, as well as a preparation method and application thereof, belonging to the technical field of plant gene engineering. The method comprises the following steps: designing an RNA interference fragment according to the coding sequence of gene OsbHLH116, performing primary digestion and linking on the interference fragment and a carrier pTCK303 to obtain an OsbHLH116-RNAi expression carrier; and transforming the rice variety Xinfeng No.2 by utilizing an agrobacterium-mediated method, and verifying the OsbHLH116 gene expression quantity in an RNAi transgenic line through qRT-PCR. Results indicate that the OsbHLH116 gene expression is remarkably reduced. Compared with a wild gene, the OsbHLH116-RNAi line has the advantage that the seed germination rate is remarkably reduced, and the OsbHLH116 gene is related to rice seed germination controlling.

Description

technical field [0001] The invention relates to an OsbHLH116 gene for controlling the germination of rice seeds, an RNAi vector, a preparation method and an application thereof, and belongs to the technical field of plant genetic engineering. Background technique [0002] Basic-helix-loop-helix (bHLH) transcription factors are a class of transcription factors widely present in eukaryotes, which play a role in the metabolism, physiological regulation, growth and development of animals and plants. important role. The bHLH transcription factor contains a highly conserved domain of about 60 amino acids, which consists of a basic region at the N-terminus that can bind to DNA and a HLH region at the C-terminus (Toledo-Ortiz et al., 2003; Carretero-Paulet al. ., 2010). As a large transcription factor family, there are 162 bHLH transcription factors in Arabidopsis and 167 bHLH transcription factors in rice (Bailey et al., 2003; Li et al., 2006). In rice, bHLH transcription factor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/113C12N15/82C07K14/415A01H5/00
CPCC07K14/415C12N15/113C12N15/8218C12N15/8267C12N2310/14
Inventor杜彦修季新赵全志陈会杰晏云孙红正张静李俊周彭廷
OwnerHENAN AGRICULTURAL UNIVERSITY