Primer group for detecting vibrio parahaemolyticus on basis of intelligent constant-temperature amplification technique, kit and method

A technology of constant temperature amplification and hemolytic Vibrio, which is applied in the field of molecular biology, can solve the problems of high technical level requirements of testing personnel, reduce the difficulty and cost of identification technology, and long testing period, so as to overcome the problems of gene polymorphism detection and accurate detection. Gene polymorphism, the effect of short detection time

Inactive Publication Date: 2018-01-30
JINAN UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The traditional biochemical identification method based on bacterial culture is laborious and time-consuming, the results are not provided in time, and sometimes the results are inaccurate
With the development of molecular biology, many identification methods based on molecular biology techniques have emerged, such as PCR-SSCP, PCR-RFLP, DNA probes, DNA chips, DNA direct sequencing, etc., with their advantages of high efficiency and specificity It is favored, but requires high technical level of testing personnel, expensive instruments, and long detection cycle. In order to meet the needs of rapid identification and classification, it provides a fast and convenient method for scientific research, shortens the identification time of Vibrio parahaemolyticus, reduces the difficulty of identification technology and Cost has always been a hot spot in related research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group for detecting vibrio parahaemolyticus on basis of intelligent constant-temperature amplification technique, kit and method
  • Primer group for detecting vibrio parahaemolyticus on basis of intelligent constant-temperature amplification technique, kit and method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Establishment of an intelligent isothermal amplification detection kit for Vibrio parahaemolyticus

[0035] Intelligent isothermal amplification detection kit for Vibrio parahaemolyticus, including intelligent isothermal amplification primer set, intelligent isothermal amplification reaction solution, Bst DNA polymerase, mismatch binding protein Tap Muts, positive control and negative control, fluorescent color reagent .

[0036] (1) Design of intelligent constant temperature amplification primers: The primers were designed with the tlh / ldh gene of Vibrio parahaemolyticus as the target gene. The primer sequences are shown in Table 1.

[0037] Table 1 Primer sequence list

[0038] primer name

Primer sequence (5'-3')

FP

TTTATATATATATAAATCCGCTCTACAACTGG (SEQ ID NO: 1)

TP

CTGGGCAGTTGTTAGCGCGATGTATTGGTC (SEQ ID NO: 2)

BP

CGGCGCGGCTGGTG (SEQ ID NO: 3)

OP1

TTGCCAAAGCGAAGAACC (SEQ ID NO: 4)

OP2

ACTTGA...

Embodiment 2

[0042] Embodiment 2 Use ESE-Quant tube scanner instrument to establish Vibrio parahaemolyticus detection method:

[0043] Utilize the test kit of embodiment 1 to detect the method for Vibrio parahaemolyticus, comprising the steps:

[0044] (1) Extraction of the DNA of the sample to be tested: Extract the sample DNA with a bacterial DNA extraction kit;

[0045] (2) Isothermal gene amplification reaction: The 25 μL reaction system contains 1.6 μmol / L of TP and FP primers, 0.8 μmol / L of BP primers, 0.5 μmol / L of OP1 and OP2 primers, 0.5 mmol / L of dNTP, and 0.6 of betaine. mol / L, (NH4)2SO4mmol / L, MgCl2 2.5mmol / L, KCl 10mmol / L, MgSO4 2mmol / L, Green I 0.5μL, pH 8.8 Tris-HCl 20mmol / L, 0.2% 6U Bst DNA polymerase, 1 μg Tap Muts, 1 μL DNA template, make up to 25 μL with deionized water; set positive control and negative control; mix the prepared PCR tube, centrifuge, and react at 63 °C for 40 min.

[0046] (3) Result judgment: place the reaction tube in the ESE-Tube Scanner for rea...

Embodiment 3

[0047] Example 3 Specificity Experiment

[0048] Using the method of Example 2, the isolated and purified Salmonella ATCC14028, Shigella sohnii CMCC51334, Staphylococcus aureus CMCC26003, Listeria monocytogenes ATCC19115, Escherichia coli ATCC25922, O157:H7ATCC43889, Pseudomonas aeruginosa ATCC9027 The DNA of E.

[0049] The identification results showed that the DNA of Vibrio parahaemolyticus ATCC17802 and Vibrio parahaemolyticus VPL4-91 were amplified normally, and the DNA of other bacteria and the negative control were not amplified. Shows good specificity.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a primer group for detecting vibrio parahaemolyticus on the basis of an intelligent constant-temperature amplification technique, a kit and a method. The detection primer groupcomprises a TP primer, an FP primer, a BP primer, an OP1 primer and an OP2 primer; the detection kit comprises a primer liquid, a reaction liquid, Bst DNA (Deoxyribonucleic Acid) polymerase, mismatchbinding proteins, a developing agent and a control group. The detection method comprises the following steps: extracting DNA to be detected; by virtue of the activity of DNA polymerase with chain replacement activity, performing amplification on a sample DNA template at 60-65 DEG C by using four specific primers and a mismatch binding protein, and detecting a pg grade of the DNA. An identification mode is that the DNA of a sample to be detected is put into a reaction system, and whether amplification is implemented or not is judged by using an ESE-tube scanner instrument, and whether the sample to be detected has vibrio parahaemolyticus DNA or not is confirmed. The primer group has the advantages of rapidness and high efficiency, operation simplicity and convenience, high specificity, high sensitivity, identification simplicity and convenience, applicability to on-site detection and the like, and is applicable to popularization and application.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a primer set, a kit and a method for detecting Vibrio parahaemolyticus based on an intelligent constant temperature amplification technology. Background technique [0002] Vibrdo pmrahaemolyticus is an important food-borne pathogen with a worldwide distribution. People eating food contaminated with this bacteria will cause diarrhea, intestinal cramps, vomiting, etc., and severe patients will also be dehydrated , shock coma, or even death. At present, the scale of food poisoning caused by Vibrio parahaemolyticus and the scale of human exposure have shown a clear upward trend, and it has become the primary food-borne pathogen in my country. Vibrio parahaemolyticus is an important item in the detection of imported and exported aquatic products. In drinking water, food testing, food poisoning source investigation, and infectious disease source investigation, it is often nece...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/689C12Q1/6844C12Q1/04C12N15/11
CPCY02A50/30
Inventor 叶蕾石磊闫鹤陈洵常彦磊
Owner JINAN UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap