Single domain antibody for recognizing human serum albumin

A human serum albumin, single domain antibody technology, applied in the direction of anti-animal/human immunoglobulins, immunoglobulins, antibody mimics/scaffolds, etc. , changing the pharmacokinetic properties of drugs and other issues to achieve the effect of prolonging the half-life

Inactive Publication Date: 2018-02-09
SHENZHEN BEIKE BIOTECH
View PDF6 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the fusion method of HSA-peptide greatly increases the molecular weight of polypeptide biopharmaceuticals, which brings many problems to production and transformation. The increase in molecular weight will also change some pharmacokinetic properties of the drug, which may make it difficult to reach the target location, which affects the efficacy of the drug

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Single domain antibody for recognizing human serum albumin
  • Single domain antibody for recognizing human serum albumin
  • Single domain antibody for recognizing human serum albumin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1 Screening the single domain antibody of HSA

[0053] 1.1 Single domain antibody phage library preparation

[0054] 1.1.1 Preparation of helper phage (BM13)

[0055] The M13KE phage (purchased from NEB #N0316S) replicon was double-digested with AlwnI and AfeI (purchased from NEB), and the artificially synthesized gene fragment was also double-digested with AlwnI and AfeI, and then ligated together with T4 ligase. After ligation, TG1 was transfected to obtain helper phage BM13. Thus, in the protoreplicon

[0056] The tctggtggtggttctggtggcggctctgagggtggtggctctgagggtggcggttctgagggtggcggctctgagggaggcggttccggtggtggctct sequence was replaced by a synthetic gene sequence, that is, a trypsin cleavage sequence was added in the phage GIII coding region. Once used as a helper phage, the trypsin digestion step was added to reduce the number of phages that did not contain the fusion target gene protein.

[0057] The synthetic gene sequence is as follows:

[0058] CCA GC...

Embodiment 2

[0100] Embodiment 2, expression of fusion protein HB5-FC

[0101] The single domain antibody gene was linked with human FC by NotI and linker (G4S), and cloned into pET22b with Nco I and Xho I restriction enzymes respectively. See the plasmid map Image 6 .

[0102] The constructed vector was transformed into E.coli / DE3, single clones were picked the next day, and cultured with shaking at 220 rpm at 37°C until the OD600 was about 0.5. After adding IPTG (working concentration: 1 mM), the expression was induced at 220 rpm at 18°C ​​for 20 hours. After the cells were collected, they were resuspended evenly in PBS (pH 7.4) and then ultrasonically disrupted. Ultrasonic crushing conditions: 600W, ultrasonic 2sec, interval 6sec, 10min in total, 16°C. After ultrasonication, centrifuge at 12000 rpm for 10 min at 4°C.

[0103] Among them, the ultrasonic supernatant of HB5-FC was purified by Protein A and then ran SDS-PAG, see image 3 . Marker strips from small to large are 14, 25,...

Embodiment 3

[0106] Example 3 Specific detection of fusion protein HF11-FC recognizing HSA

[0107] In order to prepare a stable antibody, the single-domain antibody gene is fused with human FC, and the Kozak sequence and signal peptide are introduced in front of the antibody and then cloned into pcDNA3.1. See the plasmid map Figure 7 . The introduction between the single domain antibody and FC is through the BamHI restriction endonuclease site, the single domain antibody is preceded by HindIII restriction endonuclease, and the FC is followed by XbaI restriction enzyme digestion.

[0108] The recombinant plasmid was transiently transfected into 293F, cultured for 4 days and then centrifuged, the supernatant was collected and purified with ProteinA.

[0109] The affinity of the purified HF11-FC fusion protein to human serum albumin (HSA), bovine serum albumin (BSA), goat serum (containing goat serum albumin) and horse serum (containing equine serum albumin) was detected by ELISA. ELISA d...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a single domain antibody for recognizing human serum albumin, CDR1, CDR2 and CDR3 sequences with specific recognition effects, a fusion protein prepared from the amino acid sequences and polypeptide molecules or fragments of which at least one has a treatment function, a multispecific or multifunctional molecule containing the single domain antibody, a nucleic acid moleculefor coding the above amino acid sequences, a carrier containing the amino acid sequences, a protein or polypeptide, wherein the carrier is expressed by the expression system, and a host cell for expressing the any single domain antibody, fusion protein, multispecific or multifunctional molecule, nucleic acid sequences and carrier or protein or polypeptide. Through screening, the single domain antibody with high affinity is obtained, identifies specific human serum albumin, prolongs the half-life of biopharmaceuticals and is conducive to tumor treatment.

Description

technical field [0001] The invention belongs to the technical field of antibodies, in particular to a single-domain antibody that recognizes human serum albumin. Background technique [0002] At present, the antibodies commonly used in antibody-based tumor targeting therapy are single-chain antibodies or Fab fragments of antibodies. Compared with them, single-domain antibodies only contain a variable region of the antibody heavy chain, which is the smallest fully functional antigen. The binding fragment has weak immunogenicity; it is easier to pass through the blood vessel wall. Since there is no Fc segment, it cannot bind to the Fc receptor of non-target cells and can reach the lesion more concentratedly, so it is easy to carry out genetic engineering operations. [0003] Protein drugs have been successfully and widely used in clinical treatment, and many protein drugs provide effective and unique therapeutic effects for some diseases. However, the half-life of most protei...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K16/18C07K19/00C12N15/62C12N1/15C12N1/19C12N1/21C12N5/10
CPCC07K16/18C07K2317/565C07K2319/30
Inventor吕丽慧高斌古明珠刘莹梁猛
OwnerSHENZHEN BEIKE BIOTECH