Single domain antibody for recognizing human serum albumin
A human serum albumin, single domain antibody technology, applied in the direction of anti-animal/human immunoglobulins, immunoglobulins, antibody mimics/scaffolds, etc. , changing the pharmacokinetic properties of drugs and other issues to achieve the effect of prolonging the half-life
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] Example 1 Screening the single domain antibody of HSA
[0053] 1.1 Single domain antibody phage library preparation
[0054] 1.1.1 Preparation of helper phage (BM13)
[0055] The M13KE phage (purchased from NEB #N0316S) replicon was double-digested with AlwnI and AfeI (purchased from NEB), and the artificially synthesized gene fragment was also double-digested with AlwnI and AfeI, and then ligated together with T4 ligase. After ligation, TG1 was transfected to obtain helper phage BM13. Thus, in the protoreplicon
[0056] The tctggtggtggttctggtggcggctctgagggtggtggctctgagggtggcggttctgagggtggcggctctgagggaggcggttccggtggtggctct sequence was replaced by a synthetic gene sequence, that is, a trypsin cleavage sequence was added in the phage GIII coding region. Once used as a helper phage, the trypsin digestion step was added to reduce the number of phages that did not contain the fusion target gene protein.
[0057] The synthetic gene sequence is as follows:
[0058] CCA GC...
Embodiment 2
[0100] Embodiment 2, expression of fusion protein HB5-FC
[0101] The single domain antibody gene was linked with human FC by NotI and linker (G4S), and cloned into pET22b with Nco I and Xho I restriction enzymes respectively. See the plasmid map Image 6 .
[0102] The constructed vector was transformed into E.coli / DE3, single clones were picked the next day, and cultured with shaking at 220 rpm at 37°C until the OD600 was about 0.5. After adding IPTG (working concentration: 1 mM), the expression was induced at 220 rpm at 18°C for 20 hours. After the cells were collected, they were resuspended evenly in PBS (pH 7.4) and then ultrasonically disrupted. Ultrasonic crushing conditions: 600W, ultrasonic 2sec, interval 6sec, 10min in total, 16°C. After ultrasonication, centrifuge at 12000 rpm for 10 min at 4°C.
[0103] Among them, the ultrasonic supernatant of HB5-FC was purified by Protein A and then ran SDS-PAG, see image 3 . Marker strips from small to large are 14, 25,...
Embodiment 3
[0106] Example 3 Specific detection of fusion protein HF11-FC recognizing HSA
[0107] In order to prepare a stable antibody, the single-domain antibody gene is fused with human FC, and the Kozak sequence and signal peptide are introduced in front of the antibody and then cloned into pcDNA3.1. See the plasmid map Figure 7 . The introduction between the single domain antibody and FC is through the BamHI restriction endonuclease site, the single domain antibody is preceded by HindIII restriction endonuclease, and the FC is followed by XbaI restriction enzyme digestion.
[0108] The recombinant plasmid was transiently transfected into 293F, cultured for 4 days and then centrifuged, the supernatant was collected and purified with ProteinA.
[0109] The affinity of the purified HF11-FC fusion protein to human serum albumin (HSA), bovine serum albumin (BSA), goat serum (containing goat serum albumin) and horse serum (containing equine serum albumin) was detected by ELISA. ELISA d...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com