Preparation method of small molecule functional polypeptide for promoting secretion formation of freshwater pearl

A technology of freshwater pearls and small molecules, applied in botany equipment and methods, methods based on microorganisms, biochemical equipment and methods, etc., to achieve the effect of small molecular weight of polypeptides

Inactive Publication Date: 2018-03-23
JIANGSU UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to biodiversity, the identified peptides are unique to seawater pearl oyster Pif and do not exist on other species of pearl oyster Pif. Therefore, there is no small molecule functional peptide that can be applied to freshwater pearl cultivation to promote pearl formation.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of small molecule functional polypeptide for promoting secretion formation of freshwater pearl
  • Preparation method of small molecule functional polypeptide for promoting secretion formation of freshwater pearl

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020]Embodiment 1: first extract the total RNA (5 micrograms) in the mantle tissue of the freshwater Triangular mussel, obtain single-stranded cDNA by reverse transcription PCR, and design primers (forward primer sequence 1CGGGATCCCG ATTCCAGCAGGTGTCATCACC; reverse primer sequence 2CCGCTCGAGCGGATCGCCATAGCAACCCTTTTTG) to carry out PCR Amplify the coding DNA fragment corresponding to the last 16 amino acid residues of the C-terminus of Pif protein (the complete sequence of the gene has been submitted to the GenBank nucleic acid database, accession number is MF496231) (referred to as HcPif-C16). Then use ligase to connect the HcPif-C16 gene PCR product purified by digestion gel with the plasmid vector pet28a that has been double digested (BamhI and Xhol) in advance to complete the construction of the recombinant plasmid. The constructed recombinant plasmid was transformed into the host Escherichia coli strain BL21 Rosseta Gammi DE3 for expression using the general calcium chloride...

Embodiment 2

[0022] The synthesis test is basically the same as in Example 1, except that the selected polypeptide fragment sequences are different. First, extract the total RNA (5 micrograms) in the mantle tissue of the freshwater Triangle sail mussel, obtain single-stranded cDNA by reverse transcription PCR, and design primers (forward primers) Sequence 11CGGGATCCCGTGGAGAACAGTTGTAGTTAGTCTCAGG; reverse primer sequence 12CCGCTCGAGCGGCTTCAATTTGAGTTTGTCTTTCC) for PCR amplification of 16 of the middle non-functional domain interval of the 420th to 435th position of the Pif protein (the complete sequence of the gene has been submitted to the GenBank nucleic acid database, the accession number is MF496231) The coding DNA fragment corresponding to the amino acid residue (referred to as HcPif-B16). Subsequent protein expression, purification and detection were the same as in Example 1.

Embodiment 3

[0024] The synthesis test is basically the same as in Example 1, except that the entire Pif80 protein gene sequence is selected for use, that is, at first extract the total RNA (5 micrograms) in the mantle tissue of the freshwater Triangle sail mussel, obtain single-stranded cDNA by reverse transcription PCR, and design primers (forward primer sequence 13CGGGATCCCGACCAGGCAACTCTCTGGTTGC; reverse primer sequence 14CCGCTCGAGCGGATCGCCATAGCAACCCTTTTTG) to PCR amplify the coding DNA corresponding to all 483 amino acid residues of Pif protein (the complete sequence of the gene has been submitted to the GenBank nucleic acid database by myself, accession number is MF496231) Fragment (referred to as HcPif80). Subsequent protein expression, purification and detection were the same as in Example 1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a preparation method of a small molecule functional polypeptide for promoting secretion formation of freshwater pearls, and belongs to the technical field of aquaculture organisms. The preparation method comprises the following steps: 1) cloning key functional domain sequence of a freshwater hyriopsis cumingii Pif protein and constructing a recombinant polypeptide expression vector plasmid; 2) performing in-vitro prokaryotic expression and separation-purification of a recombinant polypeptide; 3) testing calcium carbonate binding activity and immunogenicity to confirm activity and safety of the polypeptide, and directly adding into pearl culture fluid for using. Molecular weight of the polypeptide prepared by the method is small and does not cause strong immune response of pearl shells, and a peptide fragment is derived from a highly-conserved sequence of the freshwater hyriopsis cumingii Pif protein, and thus the polypeptide is suitable for being added and usedin a freshwater pearl culture process.

Description

technical field [0001] The invention belongs to the field of aquaculture biotechnology, and in particular relates to a preparation method of a small molecular functional polypeptide that promotes the formation of freshwater pearls. Background technique [0002] Pearl formation is an organic mineralization formed by the formation of aragonite calcium carbonate crystals on the matrix carrier of organic molecules such as chitosan, regulated by pearl protein, and organized in a unique nanostructure. Because of the role of pearl protein, the mechanical strength of the originally fragile calcium carbonate minerals (such as coral is composed of aragonite without protein) can reach a thousand-fold increase, and the unique nano-scale layered structure causes The refraction and scattering of light is the main cause of pearl's beautiful luster. Therefore, the amount and activity of molecules that can be combined with calcium carbonate crystals, chitosan and other pearl proteins are un...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/70C12N15/12C07K14/435C12R1/19
CPCC12N15/70C07K14/43504
Inventor王宁张锐秦梦婷石洁李怡恬田珍燕
OwnerJIANGSU UNIV