Reagent and method for identifying rabies virus vaccine strain and wild-type strain
A rabies virus vaccine and wild-type virus technology, which is applied in the field of reagents for identifying rabies virus vaccine strains and wild-type virus strains, can solve the risk of using rabies virus vaccines, cannot distinguish between wild-type virus strains and vaccine strains, and lacks rabies virus vaccines strain identification methods, etc., to achieve high specificity, sensitivity, and good sensitivity.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Embodiment 1: reagent of the present invention
[0042] RVGF (upstream primer): TGACCACMAAGTCCGTGAGTTT
[0043] RVGF (downstream primer): AGCATCAGCCTCCATCAAGGT
[0044] RVGVaP (vaccine strain probe): HEX-GGAAAAGCATATACCATATTC–MGB
[0045] RVGViP (wild-type strain probe): FAM-GGAAAGGCGTATACCATATT-MGB
Embodiment 2
[0046] Embodiment 2: reagent specificity test of the present invention
[0047] Materials: rabies virus CVS-11 vaccine strain, JX-08-45 vaccine strain and BD06 wild strain, canine distemper virus nucleic acid, canine coronavirus nucleic acid, canine rotavirus nucleic acid and canine parvovirus nucleic acid, throat swabs of healthy dogs , set a blank water control. The primers and probes used the reagents in Example 1, which were synthesized by Shanghai Sangon Biotechnology Co., Ltd., and other reagents were biologically pure reagents.
[0048] Nucleic acid extraction: Take 200 μl of culture or tissue homogenate after centrifugation at 2000g, and use QIAGEN's RNeasy mini kit to extract RNA from various materials according to the product instructions.
[0049] Reaction system and reaction conditions: amplification using One Step PrimeScript TM RT-PCR Kit (Perfect Real Time) (TaKaRa) kit is used for fluorescence amplification test in 20μl reaction system. First, add 10μl of 2×O...
Embodiment 3
[0054] Embodiment 3: Reagent sensitivity test of the present invention
[0055] Preparation of rabies virus template by in vitro transcription:
[0056] Rabies virus BD06 wild strain RNA was extracted, RT-PCR amplification was performed with primers TGACCACMAAGTCCGTGAGTTT (SEQ ID NO: 1) and AGCATCAGCCTCCATCAAGGT (SEQ ID NO: 2), and the PCR product was purified and connected to the pGEM-T vector, After the direction of the recombinant plasmid was identified, the extracted plasmid was cut into linear lines using restriction enzymes, and then transcribed in vitro according to the instructions of Invitro Transcription T7Kit (Takara). The product was digested with DNase I, precipitated with 3M sodium acetate, and dissolved in RNase-free In the water, calculate the corresponding copy number after measuring the concentration, sequentially from 10 6 copies / μl was diluted to 10 by 10 times 0 copy / μl, test according to the reaction system and reaction conditions in Example 2, to test ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


