Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A method and application for preparing H9 subtype avian influenza vaccine strains for distinguishing immune and infected animals

A technology for avian influenza and vaccine strains, applied in the field of distinguishing immune and infected H9 subtype avian influenza vaccine strains and its preparation, capable of solving problems affecting the monitoring of virus prevalence, distinguishing immunized animals from infected animals, and hindering H9 subtype avian influenza Purification and other issues, to achieve the effect of highlighting the significance of public health safety, important application value, and definite effect

Active Publication Date: 2020-09-08
ZHEJIAN DIFFERENCE BIOLOGICAL TECH CO LTD
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although the existing H9 subtype whole virus inactivated vaccine has the advantages of certain immune effect and low price, it cannot serologically distinguish immune animals from infected animals, which seriously affects the monitoring of virus epidemics and hinders the detection of H9 subtype. Purification of Type Avian Influenza in Breeding Farms

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method and application for preparing H9 subtype avian influenza vaccine strains for distinguishing immune and infected animals
  • A method and application for preparing H9 subtype avian influenza vaccine strains for distinguishing immune and infected animals
  • A method and application for preparing H9 subtype avian influenza vaccine strains for distinguishing immune and infected animals

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Example 1 The preparation method of the H9 subtype avian influenza vaccine strain Re-H9-DIVA-J2 that distinguishes between immunity and infection with influenza A virus

[0071] The pFlu vector is a bidirectional transcription vector, which can not only transcribe the RNA of the complete virus at the human polI promoter, but also transcribe the viral mRNA under the CMV promoter, thereby synthesizing the viral protein (Hoffmann et al., PNAS, USA 97,6108- 6113, 2000).

[0072] (1) Cloning the HA gene of H9 subtype avian influenza virus

[0073] The total RNA of H9 subtype avian influenza virus A / chicken / Guangdong / J2 / 2016 (referred to as J2 strain) was extracted according to the instructions of Qiagen RNeasy mini kit. A one-step RT-PCR kit (TAKARA) was used to reverse transcribe and amplify the full-length HA gene (SEQ ID NO: 1) of J2 strain. The RT-PCR primers were Up-primer: CACACACGTCTCCGGGAGCAAAAGCAGGGGAATTTC (SEQ ID NO: 7); Low-Primer: CACACACGTCTCCTATTAGTAGAAACAAAG...

Embodiment 2

[0084] Example 2 The preparation method of the H9 subtype avian influenza vaccine strain Re-H9-DIVA-J2 that distinguishes between immunity and infection with influenza A virus

[0085] The preparation method in embodiment 2 is the same as embodiment 1, except in constructing figure 1 When the A / B chimeric NA gene is artificially synthesized, the DNA sequence encoding the amino acid sequence of the extracellular domain protein in the influenza B virus NA is different from that in Example 1, and the others are the same as in Example 1.

[0086] In this embodiment, the DNA sequence encoding the amino acid sequence of the extracellular region protein in the type B influenza virus NA is shown in SEQ ID NO: 6, as the tag gene sequence, the sequence shown in SEQ ID NO: 6 is from the type B influenza virus Victoria Group B / Brisbane / 60 / 2008 (Ping J et al, PNAS, 2016, 113(51):E8296-E8305).

[0087] The Re-H9-DIVA-J2 vaccine strain prepared in this example will be further tested for its...

Embodiment 3

[0095] The preparation of embodiment 3Re-H9-DIVA-J2 inactivated vaccine

[0096]Collect 50 ml of allantoic fluid from the F0 generation of Re-H9-DIVA-J2 vaccine strain, and inactivate it with formalin solution with a final concentration of 0.25% at 37°C for 24 hours. Add 2% Tween-80 to the inactivated allantoic fluid, emulsify with white oil containing 3% Span 80 after fully dissolving, the emulsification ratio is 1:3, the shear emulsification speed is 12000rpm, 3min. Through dosage form inspection, particle size inspection, viscosity inspection, and stability inspection, it is determined that the inactivated oil seedlings are milky white water-in-oil emulsion with low viscosity, uniform particle size, good stability, and suitable for injection.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an H9 subtype avian influenza vaccine strain for distinguishing immunized and infected animals, a preparation method and application thereof. The present invention uses the NA gene of type B influenza virus as a label for the first time to develop a method for preparing H9 novel avian influenza vaccine that distinguishes immunity from infection. Conventional H9 subtype avian influenza whole-virus inactivated vaccines are effective, but they cannot serologically distinguish antibodies produced by immunization and infection, which poses a huge obstacle to the monitoring and purification of avian influenza. In the successfully constructed H9 subtype avian influenza vaccine strain for distinguishing immunity and infection, the NA gene and HA gene have good compatibility, exhibit good biological characteristics such as replication and growth, and do not require in vitro passage Adaptation avoids the disadvantage of antigenic variation caused by passage adaptation. Even if it continues for 3 generations, it still maintains the characteristics of low pathogenicity to chicken embryos and high titer growth. The invention has important significance and application value for the prevention, control and purification of H9 subtype avian influenza.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering vaccines, and in particular relates to an H9 subtype avian influenza vaccine strain for distinguishing immunity from infection, a preparation method and application thereof. Background technique [0002] Avian influenza viruses belong to the family Orthomyxoviridae and the genus Influenzavirus. Influenza viruses can be divided into A, B, and C types according to their antigenicity. Type A influenza has a wide range of hosts (including birds, humans, pigs, etc.) and is more pathogenic and harmful. Influenza B only infects humans and seals, and its pathogenicity is relatively low. Type C influenza virus, found only in humans and pigs. The genomes of influenza A and B can be divided into eight gene segments: PB2, PB1, PA, NP, HA, NA, M, and NS. After the host is infected, a large number of antibodies can be produced against HA, NA, M1 and NP. Among them, HA can directly induce the mai...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/62C07K19/00C12N7/01C12N15/87A61K39/145A61P31/16
CPCA61K39/12C12N7/00C12N15/87C07K14/005A61K2039/5252A61K2039/552C07K2319/02C07K2319/03C12N2760/16234C12N2760/16221C12N2760/16222C12N2760/16122C12N2760/16134C12N2760/16121A61K39/145A61K2039/5256C12N2760/16151
Inventor 宋家升
Owner ZHEJIAN DIFFERENCE BIOLOGICAL TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products