Primer group and probe for detecting ostreid herpesvirus of infected scapharca subcrenata, and application of primer group and probe

A technology of oyster herpes virus and primer set, which is applied in the direction of biochemical equipment and methods, microbial measurement/inspection, etc. It can solve the problems of difficult design, high cost of RPA primers and probes, and achieve low requirements for equipment and rapid response , the effect of high sensitivity

Active Publication Date: 2018-05-22
SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI +1
View PDF6 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the cost of RPA primers and probes is high, and the design is difficult. There is no professional design software similar to PCR primers, and there are no guidelines for reference. The sensitivity and specificity of the detection completely depend on the experience of the primer designer and a large number of experimental verifications.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group and probe for detecting ostreid herpesvirus of infected scapharca subcrenata, and application of primer group and probe
  • Primer group and probe for detecting ostreid herpesvirus of infected scapharca subcrenata, and application of primer group and probe
  • Primer group and probe for detecting ostreid herpesvirus of infected scapharca subcrenata, and application of primer group and probe

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Design and specificity detection of embodiment 1 primer set and probe

[0024] According to the virus ORF 95 (GenBank accession no.AY509253.2) nucleic acid sequence design primer set and probe set, wherein the target gene sequence is as follows:

[0025]

[0026] Primer sets are:

[0027] Forward primer FP: catgtttacg tggaaatgtt ggattggcta 30

[0028] Reaction primer RP: atgtcaaata ggttgttggc agtgatggtc 30

[0029] The probe sequence is:

[0030] tacagcatcg cccgatgcac ttcgtgat(dT-FAM)ca(THF)tt(dT-BHQ1)atcggctcaatatata(C3spacer)

[0031] Specific detection: establish a positive control containing OsHV-1 plasmid, ddH 2 O negative control, shrimp virus (WSSV) genomic DNA control, abalone herpes virus (AbHV) control, grouper viral neuronecrosis virus (RGNNV) control, Harvey Vibrio genomic DNA control, Dongfeng snail genomic DNA control, The water body DNA control and the healthy prawn genome DNA control were detected using these genome DNA as templates.

[0032] Gr...

Embodiment 2

[0044] Example 2 Sensitivity Verification

[0045] RPA products were used to construct recombinant plasmids. The plasmid is formed by connecting the target gene fragment and the PMD18-T vector.

[0046] The vector sequence has been made public: http: / / wenku.baidu.com / view / 385564bdf121dd36a32d8271.html.

[0047] Detection by absolute quantification method: the constructed plasmid standard was treated with ddH 2 O was diluted 10 times to construct different concentration gradients of 10 6 、10 5 、10 4 、10 3 、10 2 , 10 and 5 to make a standard curve, use ddH 2O was used as a negative control, and each concentration was repeated three times. The RPA amplification reaction was performed using a real-time fluorescent quantitative PCR instrument (Eppendorf).

[0048] reaction system:

[0049] Rehydration buffer (Twistdx kit, TAEXO02KIT): 14.7μL

[0050] RPA FP (10 μM): 1.1 μL

[0051] RPA RP (10 μM): 1.1 μL

[0052] Probe (10μM): 0.3μL

[0053] f 2 O: 4.6 μL

[0054] D...

Embodiment 3

[0060] Embodiment 3 Feasibility verification

[0061] In order to further confirm the reliability of the qRPA detection system of the present invention, we randomly selected 50 cockles, and simultaneously performed qRPA and qPCR detection of the OsHV-1 content in their bodies. The clam DNA was extracted using a mollusk animal extraction kit (Magen, Guangdong, China), and the specific operation was performed according to the instructions.

[0062] The qRPA detection method, primer set and probe are the same as in Example 2.

[0063] The qPCR detection method used the reported SYBR Green detection method (Pepin, Riou et al. (2008). "Rapid and sensitive detection of ostreid herpesvirus 1 in oystersamples by real-time PCR". Journal of Virological Methods). The construction method of qPCR bracket is similar to the construction method of qRPA bracket in Example 2.

[0064] The primer sequences used are:

[0065] C9: GAGGGAAATTTGCGAGAGAA

[0066] C10: ATCACCGGCAGACGTAGG

[0067]...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer group and probe for detecting ostreid herpesvirus of infected scapharca subcrenata, and application of the primer group and probe. The primer group consists of a forward primer and a backward primer; the base sequence of the forward primer is as shown in SEQ ID NO. 1, and the base sequence of the backward primer is as shown in SEQ ID NO. 2. The base sequence of theprobe is as shown in SEQ ID NO. 3. The invention further discloses application of the primer group and the probe in preparation of a reagent for RPA detecting the ostreid herpesvirus of the infectedscapharca subcrenata. The reagent is short in virus detection time, high in yield and high in specificity; positive and negative results have an obvious difference, so that the verification rate is high, and the reagent is more obvious and reliable.

Description

technical field [0001] The invention belongs to the technical field of oyster herpes virus, and in particular relates to a primer set and a probe for detecting oyster herpes virus infecting cockles and an application thereof. Background technique [0002] Oyster herpesvirus (Ostreid herpesvirus, OsHV) belongs to the Herpesvirus genus, and is a serious pathogen to shellfish farming. The virus can infect and kill a variety of bivalve molluscs, including oysters, scallops, clams, and clams. Since the 1990s, bivalve molluscs such as long oysters (Crassostrea gigas) cultured in many countries and regions around the world and Chlamys farreri in my country have often suffered large-scale deaths during the high temperature season in summer, which has caused serious damage to the shellfish farming industry. brought huge economic losses. At present, there is no effective treatment for this viral disease, and early and accurate detection of the virus is particularly important for the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/70C12Q1/6844
CPCC12Q1/6844C12Q1/705C12Q2521/507C12Q2521/101
Inventor姜敬哲高芳王江勇
OwnerSOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI