Primer and probe for detecting siniperca chuatsi on basis of fluorescent quantitative PCR as well as kit and method thereof

A fluorescence quantification and cocked mandarin fish technology, applied in the field of molecular biology, can solve the problems of large influence of subjective judgment, poor repeatability, complicated operation, etc., and achieve the effects of avoiding aerosol pollution, short detection time and strong specificity

Inactive Publication Date: 2018-05-29
JINAN UNIVERSITY
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are few reports on the identification of mandarin fish, mainly relying on the traditional morphological identification method, but practitioners need to have strong professional background knowledge, and are greatly affected by subjective judgment, especially when the fish is young, damaged or corrupt. It is difficult to identify and error-prone
The detection methods based on molecular biology mainly include microsatellite molecular markers, random primer amplification polymorphism, restriction length polymorphism, etc., but these methods have disadvantages such as time-consuming, complicated operation, poor repeatability, and large errors.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and probe for detecting siniperca chuatsi on basis of fluorescent quantitative PCR as well as kit and method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 The establishment of a detection kit for rapid identification of cockroaches based on fluorescence quantitative PCR technology

[0033] A detection kit based on fluorescent quantitative PCR technology for rapid identification of mandarin fish, including primer set, PCR MIX reaction solution, deionized water, positive control and negative control.

[0034] (1) Design of fluorescent quantitative PCR amplification primers: The primers were designed with the specific conserved sequence of Siniperca sinensis as the target gene. See Table 1 for primer sequences.

[0035] Table 1 Primer sequence list

[0036] Primer name

Primer sequence (5'-3')

FP

CACCATAAAACTATATTAACCATA (SEQ ID NO: 1)

BP

CAAGGTATATCTTGACTTATGA (SEQ ID NO: 2)

Probe

TTTCGTCAGTCTTACTTCCATTTATGT (SEQ ID NO: 3)

[0037] (2) Fluorescence quantitative PCR MIX reaction solution contains: 5U Taq enzyme, 2.5mM dNTPs, 25mM MgCl2, 2×PCRbuffer.

[0038] (3) ...

Embodiment 2

[0040] Example 2 Detection method for rapid identification of cockroaches based on fluorescence quantitative PCR technology

[0041] Utilize the method for the test kit of embodiment 1 to detect cocked mandarin fish, comprise the steps:

[0042] (1) Extraction of DNA from the sample to be tested;

[0043] (2) Fluorescence quantitative PCR reaction system: 25 μL reaction system contains 1 μL of 10 μmol / L FP and BP primers, 0.5 μL of 10 μmol / L probe, 12.5 μL of PCR MIX reaction solution, 5 μL of template, make up to 25 μL with deionized water ; Positive control and negative control are set; the prepared PCR tube is mixed and then centrifuged, and placed in a fluorescent PCR instrument (such as ABI7500) for reaction.

[0044] (3) The reaction procedure is as follows: react at 95°C for 10 min; react at 95°C for 15 sec, and react at 60°C for 60 sec, 45 cycles, and collect fluorescence signals at the end of each cycle of extension.

[0045] (4) Judgment of the results: Observe the...

Embodiment 3

[0046] Embodiment 3 specificity experiment

[0047] The detection method of the present invention detects actual samples. The samples come from an aquatic product market in Guangzhou and a fresh food website, including blue grouper, duckbill, yellow croaker, perch, silver pomfret, salmon, golden pomfret, Zhoushan pomfret, Wuhan 37 samples including grass carp, Alaska golden flounder, South American gray pomfret, turbot, Malaysian silver pomfret, East kelp, mandarin fish, Wuhan mandarin fish, Russian saury, East China sea pomfret, crucian carp, etc., all samples were sequenced Verify its genus and species, see the test results figure 1 . Judging from the detection in the figure, the scheme of the present invention has good specificity.

[0048]In addition, using the method and kit of the present invention for the detection of actual detection samples, the detection of 367 sample fishes provided by inspection and quarantine departments and multiple inspection stations of quali...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a detection primer and probe for rapidly identifying siniperca chuatsi on the basis of a quantitative PCR technology, and a detection kit and detection method adopting the primer and the probe. A detection primer group comprises an upstream primer FP, a downstream primer BP and a probe; and the detection kit comprises a primer solution, a PCR MIX reaction solution, deionized water, a negative control and a positive control. The detection method comprises the following steps: extracting DNA of a sample to be detected, quickly detecting the DNA of the sample to be detected by using a fluorescent quantitative PCR technology, and judging whether the sample to be detected is siniperca chuatsi or not through a real-time amplification curve. The detection primer, the probe, the kit and the method provided by the invention have the advantages of rapidity, sensitivity, specificity, easy operation and the like, and are suitable for popularization and application.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a primer, a probe, a reagent kit and a method for detecting mandarin fish based on fluorescence quantitative PCR. Background technique [0002] Siniperca chuatsi (Siniperca chuatsi), belonging to the class Osteophytes, subclass Radix, and order Perciformes, is a rare and precious freshwater fish special in my country. There are few spines in the fish meat, the meat is tender, thick, delicious, and rich in nutrition. It is a famous and high-quality variety with high market price and good economic benefits. At present, there are few reports on the identification of mandarin fish, mainly relying on the traditional morphological identification method, but practitioners need to have strong professional background knowledge, and are greatly affected by subjective judgment, especially when the fish is young, damaged or corrupt. It is difficult to identify and error-prone. The ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6888C12Q1/686C12N15/11
CPCC12Q1/686C12Q1/6888C12Q2563/107C12Q2545/114
Inventor叶蕾曹炜伟陈洵白卫滨徐明芳常彦磊石磊
OwnerJINAN UNIVERSITY