Primer and probe for detecting siniperca chuatsi on basis of fluorescent quantitative PCR as well as kit and method thereof
A fluorescence quantification and cocked mandarin fish technology, applied in the field of molecular biology, can solve the problems of large influence of subjective judgment, poor repeatability, complicated operation, etc., and achieve the effects of avoiding aerosol pollution, short detection time and strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1 The establishment of a detection kit for rapid identification of cockroaches based on fluorescence quantitative PCR technology
[0033] A detection kit based on fluorescent quantitative PCR technology for rapid identification of mandarin fish, including primer set, PCR MIX reaction solution, deionized water, positive control and negative control.
[0034] (1) Design of fluorescent quantitative PCR amplification primers: The primers were designed with the specific conserved sequence of Siniperca sinensis as the target gene. See Table 1 for primer sequences.
[0035] Table 1 Primer sequence list
[0036] Primer name
Primer sequence (5'-3')
FP
CACCATAAAACTATATTAACCATA (SEQ ID NO: 1)
BP
CAAGGTATATCTTGACTTATGA (SEQ ID NO: 2)
Probe
TTTCGTCAGTCTTACTTCCATTTATGT (SEQ ID NO: 3)
[0037] (2) Fluorescence quantitative PCR MIX reaction solution contains: 5U Taq enzyme, 2.5mM dNTPs, 25mM MgCl2, 2×PCRbuffer.
[0038] (3) ...
Embodiment 2
[0040] Example 2 Detection method for rapid identification of cockroaches based on fluorescence quantitative PCR technology
[0041] Utilize the method for the test kit of embodiment 1 to detect cocked mandarin fish, comprise the steps:
[0042] (1) Extraction of DNA from the sample to be tested;
[0043] (2) Fluorescence quantitative PCR reaction system: 25 μL reaction system contains 1 μL of 10 μmol / L FP and BP primers, 0.5 μL of 10 μmol / L probe, 12.5 μL of PCR MIX reaction solution, 5 μL of template, make up to 25 μL with deionized water ; Positive control and negative control are set; the prepared PCR tube is mixed and then centrifuged, and placed in a fluorescent PCR instrument (such as ABI7500) for reaction.
[0044] (3) The reaction procedure is as follows: react at 95°C for 10 min; react at 95°C for 15 sec, and react at 60°C for 60 sec, 45 cycles, and collect fluorescence signals at the end of each cycle of extension.
[0045] (4) Judgment of the results: Observe the...
Embodiment 3
[0046] Embodiment 3 specificity experiment
[0047] The detection method of the present invention detects actual samples. The samples come from an aquatic product market in Guangzhou and a fresh food website, including blue grouper, duckbill, yellow croaker, perch, silver pomfret, salmon, golden pomfret, Zhoushan pomfret, Wuhan 37 samples including grass carp, Alaska golden flounder, South American gray pomfret, turbot, Malaysian silver pomfret, East kelp, mandarin fish, Wuhan mandarin fish, Russian saury, East China sea pomfret, crucian carp, etc., all samples were sequenced Verify its genus and species, see the test results figure 1 . Judging from the detection in the figure, the scheme of the present invention has good specificity.
[0048]In addition, using the method and kit of the present invention for the detection of actual detection samples, the detection of 367 sample fishes provided by inspection and quarantine departments and multiple inspection stations of quali...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com