Trans-4-hydroxy-L-proline synthesis strain as well as L-proline hydroxylase gene and application thereof

A technology of proline hydroxylase and proline, which is applied in the field of microorganisms and genetic engineering, can solve the problems of low efficiency and high residue of L-proline, and achieve the effect of improving production efficiency

Active Publication Date: 2018-06-01
HEBEI UNIVERSITY
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The second object of the present invention is to provide a L-proline hydroxylase gene derived from the above-mentioned bacterial strain with trans-4-hydroxyl-L-proline production capacity, to further overcome the existing trans- 4-Hydroxy-L-proline production method is inefficient, and the residual amount of L-proline in the synthetic product is high, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Trans-4-hydroxy-L-proline synthesis strain as well as L-proline hydroxylase gene and application thereof
  • Trans-4-hydroxy-L-proline synthesis strain as well as L-proline hydroxylase gene and application thereof
  • Trans-4-hydroxy-L-proline synthesis strain as well as L-proline hydroxylase gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Construction of strain HBU-AI gene library and extraction of hydroxylase gene

[0044] (1) Extract the genomic DNA of Bacillus cereus HBU-AI, and use Sau3AI to digest the total DNA of strain HBU-AI. The digestion system is: endonuclease 2 uL, DNA 1.5 uL, 10 X Buffer 5 uL, total volume 50 uL, the rest ddH 2 O supplementation, 37 ℃, reaction 60min.

[0045] (2) Connect with BamHI digestion vector pUC19, the digestion system is: endonuclease 2 uL, DNA 1.5 uL, 10 X Buffer 5 uL, total volume 50 uL, the remaining ddH 2 O supplementation, 37 ℃, reaction 15min.

[0046] (3) Ligate the digested DNA fragments with the digested vector pUC19, and electrotransform the recipient strain E.coli DH5a with the ligation product, spread the colonies on LB plates containing ampicillin, and incubate them upside down at 37°C for 16-20 h , inoculate the grown single colony into the corresponding 96-well plate of LB liquid medium containing 3 g / L L-proline, culture it at 37 ℃ for 24 h, and u...

Embodiment 2

[0053] Example 2 Construction of Engineering Escherichia coli co-expressed with L-proline hydroxylase gene and ProBA gene

[0054] (1) Acquisition of ProBA gene

[0055] Using the genomic DNA of the Escherichia coli DH5a strain as a template, the primers F-proB: TATGGTACCAACTGCCGCTAGGCTTGCTG (shown in SEQ ID NO.4) and R-proA: GTAGGATCCCGTCAATGGCCTTGTGAATC (shown in SEQ ID NO.5) were used to amplify the proBA gene fragment; It is connected with the cloning vector PMD19, transformed into Escherichia coli DH5a strain, screened for positive transformants, and sequenced to verify the correctness of the sequence.

[0056] (2) Construction of recombinant strains

[0057] Using the aforementioned plasmid PMD19-Bp4h as a template, carry out double digestion with EcoRI and BamHI respectively, and recover the target fragment; perform double digestion with EcoRI and BamHI on the expression vector pTRC99a to linearize it, and recover the target fragment; the above two Fragments were liga...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention provides a trans-4-hydroxy-L-proline synthesis strain. The strain is bacillus cereus HBU-AI; the preservation unit is China General Microbiological Culture Collection Center (CGMCC) andthe preservation number is CGMCC No. 14164; the preservation date is May 17, 2017. The invention further provides an L-proline hydroxylase gene sequence of the strain and application of an L-proline hydroxylase gene to production of trans-4-hydroxy-L-proline. A result shows that the engineering strain containing the L-proline hydroxylase gene has a relatively high capability of synthesizing the trans-4-hydroxy-L-proline; when the strain is fermented for 52h, the concentration of hydroxyproline in a fermentation solution can reach 41.6g / L and the residual concentration of L-proline in a productis 0.8g / L.

Description

technical field [0001] The invention belongs to the technical field of microorganisms and genetic engineering, and in particular relates to a trans-4-hydroxy-L-proline synthetic strain and its L-proline hydroxylase gene and application. Background technique [0002] trans-4-hydroxy-L-proline ( trans -4-Hydroxy-L-proline, trans -Hyp) is an imino acid, which is the product of hydroxylation of L-proline (L-Pro). It is easy to derivatize and has various pharmacological activities. It can be used for a new generation of penem antibiotics, antineoplastic drugs, antihypertensive drugs and new Synthesis of various newly created drugs such as gastric medicine. Due to its anti-oxidation and anti-radiation effects, this substance also has important applications in the field of cosmetics. [0003] The production methods of trans-4-hydroxyl-L-proline mainly include biological extraction method and biological enzyme catalytic conversion method. The biological extraction method mainly ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/20C12N9/02C12N15/53C12N15/70C12N1/21C12P13/24C12R1/085C12R1/19
CPCC12N9/0071C12P13/24C12Y114/11002C12N1/205C12R2001/085
Inventor李玮张红蕾张超裴朝红韩孟楠徐志栋
OwnerHEBEI UNIVERSITY