Trans-4-hydroxy-L-proline synthesis strain as well as L-proline hydroxylase gene and application thereof
A technology of proline hydroxylase and proline, which is applied in the field of microorganisms and genetic engineering, can solve the problems of low efficiency and high residue of L-proline, and achieve the effect of improving production efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Construction of strain HBU-AI gene library and extraction of hydroxylase gene
[0044] (1) Extract the genomic DNA of Bacillus cereus HBU-AI, and use Sau3AI to digest the total DNA of strain HBU-AI. The digestion system is: endonuclease 2 uL, DNA 1.5 uL, 10 X Buffer 5 uL, total volume 50 uL, the rest ddH 2 O supplementation, 37 ℃, reaction 60min.
[0045] (2) Connect with BamHI digestion vector pUC19, the digestion system is: endonuclease 2 uL, DNA 1.5 uL, 10 X Buffer 5 uL, total volume 50 uL, the remaining ddH 2 O supplementation, 37 ℃, reaction 15min.
[0046] (3) Ligate the digested DNA fragments with the digested vector pUC19, and electrotransform the recipient strain E.coli DH5a with the ligation product, spread the colonies on LB plates containing ampicillin, and incubate them upside down at 37°C for 16-20 h , inoculate the grown single colony into the corresponding 96-well plate of LB liquid medium containing 3 g / L L-proline, culture it at 37 ℃ for 24 h, and u...
Embodiment 2
[0053] Example 2 Construction of Engineering Escherichia coli co-expressed with L-proline hydroxylase gene and ProBA gene
[0054] (1) Acquisition of ProBA gene
[0055] Using the genomic DNA of the Escherichia coli DH5a strain as a template, the primers F-proB: TATGGTACCAACTGCCGCTAGGCTTGCTG (shown in SEQ ID NO.4) and R-proA: GTAGGATCCCGTCAATGGCCTTGTGAATC (shown in SEQ ID NO.5) were used to amplify the proBA gene fragment; It is connected with the cloning vector PMD19, transformed into Escherichia coli DH5a strain, screened for positive transformants, and sequenced to verify the correctness of the sequence.
[0056] (2) Construction of recombinant strains
[0057] Using the aforementioned plasmid PMD19-Bp4h as a template, carry out double digestion with EcoRI and BamHI respectively, and recover the target fragment; perform double digestion with EcoRI and BamHI on the expression vector pTRC99a to linearize it, and recover the target fragment; the above two Fragments were liga...
PUM
Property | Measurement | Unit |
---|---|---|
concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com