ApoE-CRISPR/Cas9 carrier and application thereof to ApoE gene knockout

A gene and carrier technology, applied in the field of genetic engineering, can solve the problem of lack of animal models and achieve the effect of accelerating the modeling process

Inactive Publication Date: 2018-06-12
NANJING MEDICAL UNIV
View PDF2 Cites 29 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The lack of suitable animal models is the main bottleneck in the pathogenesis analysis and drug screening and evaluation of many major diseases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • ApoE-CRISPR/Cas9 carrier and application thereof to ApoE gene knockout
  • ApoE-CRISPR/Cas9 carrier and application thereof to ApoE gene knockout
  • ApoE-CRISPR/Cas9 carrier and application thereof to ApoE gene knockout

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1A

[0045] Construction of embodiment 1ApoE-PX330 vector

[0046] First, according to the porcine ApoE gene sequence (SSU70240) published in Genbank, exon 2 of the ApoE gene was selected as the CRISPR / Cas9 target. NGG), the design guide sequence GCTTCTGGGATTACCTGCGC see figure 1 .

[0047] The ApoE-CRISPR / Cas9 vector was prepared as follows:

[0048] Step 1. According to the principle of cas9 target design: G at the 5' end and PAM sequence (NGG) at the 3' end, find the target position on the ApoE gene;

[0049] Step 2. Purchase the pX330 backbone plasmid (Addgene plasmid 423230) expressing hSpCas9 and gRNA;

[0050] Step 3. The company synthesizes the 5' end phosphorylated oligonucleotide chain SgRNA sequence GCTTCTGGGATTACCTGCGC.

[0051] Cloning the sgRNA sequence into the pX330 backbone vector, the specific steps are as follows:

[0052] 1. Digest 1ug pX330 plasmid with restriction endonuclease BbsI;

[0053] 2. Run the digested pX330 plasmid on agarose gel (the concentra...

Embodiment 2

[0071] Embodiment 2 utilizes the method of somatic cell cloning to create the Bama miniature pig cell of ApoE gene knockout

[0072] Step 1. Recovery of porcine primary fibroblasts

[0073] 1. Take out the frozen primary porcine fibroblasts from liquid nitrogen, and thaw them in a 37°C water bath;

[0074] 2. Transfer the thawed cells into a sterile 15mL centrifuge tube, then add 3mL cell culture medium, and centrifuge at 1500rpm for 5min;

[0075] Wherein, the formula of the cell complete medium is: 16% fetal bovine serum (Gibco)+84% DMEM medium (Gibco), 16% and 84% are volume percentages.

[0076] 3. Discard the supernatant, add 2mL complete medium to resuspend the cell pellet, then spread the resuspended cells into a 6cm cell culture dish, add 2mL complete medium, and place at 37°C, 5% CO 2 Cultivate in the constant temperature incubator of (volume percentage);

[0077] 4. When the cells are cultured to about 90% of the bottom of the dish, use 0.05% (5g / 100mL) trypsin to...

Embodiment 3

[0123] Example 3 Phenotype analysis of ApoE gene knockout Bama miniature pigs.

[0124] 1. Detection of ApoE protein expression in ApoE knockout Bama miniature pigs

[0125] Use non-anticoagulant blood collection tubes for post-weaning ApoE gene knockout mini-pigs, let stand for more than 1 hour, put the blood collection tubes into a centrifuge after the serum is precipitated in the tube, centrifuge at 3000r / min for 10 minutes, and take the upper clear liquid as serum . After diluting the serum, perform protein electrophoresis on polyacrylamide gel (SDS-PAGE), then use a transfer device to transfer the protein on the electrophoresed polyacrylamide gel to PVDF membrane, and finally use Apolipoprotein E / ApoE antibody (NOVUS NBP1-31123) to detect the knockout of ApoE gene, see image 3 , where WT is wild-type Bama minipigs, M1, M2, M3, M6, M7, M10 are ApoE gene knockdown Bama minipigs, M4, M5, M8, M9 are ApoE gene knockout Bama minipigs .

[0126] 2. After high-fat feeding, t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a SgRNA (single chain guide ribonucleic acid) of the exon 2 of a specific targeted ApoE gene. The nucleotide sequence of the SgRNA is GCTTCTGGGATTACCTGCGC. The invention also discloses an ApoE-CRISPR / Cas9 carrier containing the SgRNA and application of the ApoE-CRISPR / Cas9 carrier to structuring ApoE gene knockout mammal models and to preparing ApoE gene knockout kits. TheApoE-CRISPR / Cas9 carrier structures the ApoE gene knockout mammal models; ApoE gene knockout can affect in vivo lipid metabolism of mammals and accelerate the pathogenic processes of lipid metabolismcorrelated diseases such as atherosclerosis to further accelerate the modeling process of corresponding mammal disease models and provide animal experiment basis for research on diseases such as atherosclerosis.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering and relates to gene knockout, in particular to an ApoE-CRISPR / Cas9 carrier and its application in knockout of the ApoE gene. Background technique [0002] Cardiovascular disease is the "number one killer" of Chinese residents' health. The "China Cardiovascular Disease Report 2015" report shows that: out of every 5 deaths in China, 2 died of cardiovascular disease. Atherosclerosis (AS) is a chronic inflammatory disease of the arterial wall, and is the main pathological basis of cardiovascular and cerebrovascular diseases. AS manifests as large and medium-sized elastic blood vessels, and lipid deposition occurs in the intima and subintima of the muscular artery wall, forming atherosclerotic lesions or fibrolipid plaques, resulting in narrowing of the arterial lumen, and then the plaque ruptures and falls off. The formation of thrombus in the body leads to the occurrence of ischemic card...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/85C12N15/90C12N15/877A01K67/027
CPCA01K67/0276A01K2217/075A01K2227/108A01K2267/0362C07K14/775C12N9/22C12N15/113C12N15/8509C12N15/8778C12N15/907C12N2310/10C12N2800/107C12N2810/10
Inventor戴一凡杨海元王盈
OwnerNANJING MEDICAL UNIV