ApoE-CRISPR/Cas9 carrier and application thereof to ApoE gene knockout
A gene and carrier technology, applied in the field of genetic engineering, can solve the problem of lack of animal models and achieve the effect of accelerating the modeling process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1A
[0045] Construction of embodiment 1ApoE-PX330 vector
[0046] First, according to the porcine ApoE gene sequence (SSU70240) published in Genbank, exon 2 of the ApoE gene was selected as the CRISPR / Cas9 target. NGG), the design guide sequence GCTTCTGGGATTACCTGCGC see figure 1 .
[0047] The ApoE-CRISPR / Cas9 vector was prepared as follows:
[0048] Step 1. According to the principle of cas9 target design: G at the 5' end and PAM sequence (NGG) at the 3' end, find the target position on the ApoE gene;
[0049] Step 2. Purchase the pX330 backbone plasmid (Addgene plasmid 423230) expressing hSpCas9 and gRNA;
[0050] Step 3. The company synthesizes the 5' end phosphorylated oligonucleotide chain SgRNA sequence GCTTCTGGGATTACCTGCGC.
[0051] Cloning the sgRNA sequence into the pX330 backbone vector, the specific steps are as follows:
[0052] 1. Digest 1ug pX330 plasmid with restriction endonuclease BbsI;
[0053] 2. Run the digested pX330 plasmid on agarose gel (the concentra...
Embodiment 2
[0071] Embodiment 2 utilizes the method of somatic cell cloning to create the Bama miniature pig cell of ApoE gene knockout
[0072] Step 1. Recovery of porcine primary fibroblasts
[0073] 1. Take out the frozen primary porcine fibroblasts from liquid nitrogen, and thaw them in a 37°C water bath;
[0074] 2. Transfer the thawed cells into a sterile 15mL centrifuge tube, then add 3mL cell culture medium, and centrifuge at 1500rpm for 5min;
[0075] Wherein, the formula of the cell complete medium is: 16% fetal bovine serum (Gibco)+84% DMEM medium (Gibco), 16% and 84% are volume percentages.
[0076] 3. Discard the supernatant, add 2mL complete medium to resuspend the cell pellet, then spread the resuspended cells into a 6cm cell culture dish, add 2mL complete medium, and place at 37°C, 5% CO 2 Cultivate in the constant temperature incubator of (volume percentage);
[0077] 4. When the cells are cultured to about 90% of the bottom of the dish, use 0.05% (5g / 100mL) trypsin to...
Embodiment 3
[0123] Example 3 Phenotype analysis of ApoE gene knockout Bama miniature pigs.
[0124] 1. Detection of ApoE protein expression in ApoE knockout Bama miniature pigs
[0125] Use non-anticoagulant blood collection tubes for post-weaning ApoE gene knockout mini-pigs, let stand for more than 1 hour, put the blood collection tubes into a centrifuge after the serum is precipitated in the tube, centrifuge at 3000r / min for 10 minutes, and take the upper clear liquid as serum . After diluting the serum, perform protein electrophoresis on polyacrylamide gel (SDS-PAGE), then use a transfer device to transfer the protein on the electrophoresed polyacrylamide gel to PVDF membrane, and finally use Apolipoprotein E / ApoE antibody (NOVUS NBP1-31123) to detect the knockout of ApoE gene, see image 3 , where WT is wild-type Bama minipigs, M1, M2, M3, M6, M7, M10 are ApoE gene knockdown Bama minipigs, M4, M5, M8, M9 are ApoE gene knockout Bama minipigs .
[0126] 2. After high-fat feeding, t...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


