Method for producing N-acetylneuraminic acid through recombinant bacillus subtilis whole-cell transformation

A technology of Bacillus subtilis and neuraminidase aldolase, which is applied in the field of genetic engineering, can solve the problems of high cost, difficult separation, complicated process and the like, and achieves the effects of simple method, good application prospect and easy use.

Inactive Publication Date: 2018-07-17
JIANGNAN UNIV
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, N-acetylneuraminic acid is mainly extracted from relatively rich natural materials such as bovine colostrum, egg yolk, casein, and bird’s nest, and synthesized through a series of reaction chemical methods. The cost is high, the process is complicated and difficult to separate, and the environment is seriously polluted. , not suitable for industrial production
The existing production method has low output and high cost, and it is difficult to meet the market demand. Therefore, how to establish a cost-effective production method to produce safer and more reliable N-acetylneuraminic acid has become a problem worthy of further discussion.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing N-acetylneuraminic acid through recombinant bacillus subtilis whole-cell transformation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 Construction of recombinant plasmid

[0034] Primers were designed according to the N-acetylneuraminic acid aldolase gene (NanA) of Escherichia coli (Escherichia coli K12, GenBank: U05248.1) published on NCBI:

[0035] NanA-F: '-CGGGGTACCATTATAGGTAAGAGAGGAATGTACACATGGCAACGAATTTACGTGGCG3', NanA-R: 5'-TTGCCCATTGATCCTTCCTCCTTTTCACCCGCGCTCTTGCATC-3', using the synthetic N-acetylneuraminic acid synthase group as a template to amplify the gene NanA fragment, according to the NCBI published on the Candida (Anabaena sp. .CH1, GenBank: DQ661858.1) N-acetylglucosamine isomerase gene (AGE), after optimized codon preference by Bacillus subtilis, gene synthesis (as shown in SEQ ID NO.4), design primers:

[0036]AGE-F: 5'-GATGCAAGAGGCGCGGGTGAAAAGGAGGAAGGATCAATGGGCAAAAACTTACAAGCTCTGG-3', AGE-R: 5'-TCCCCCGGGTTATGAAAGTGCTTCAAACTGTTGCC-3',

[0037] Use the above primers to amplify the AGE gene fragment with the synthetic N-acetylglucosamine isomerase base as the template, the ...

Embodiment 2

[0038] Example 2 Construction of recombinant pP43NMK-NA plasmid Bacillus subtilis

[0039] The constructed pP43NMK-NA plasmid was transformed into Bacillus subtilis B6CG. Using NanA-F and AGE-R primers to select transformants for colony PCR, the gel electrophoresis confirmed that a 2115bp band appeared, which confirmed that the recombinant Bacillus subtilis B6CGNA was successfully constructed.

Embodiment 3

[0040] Example 3 Whole cell transformation method to produce N-acetylneuraminic acid

[0041] Collect the recombinant Bacillus subtilis B6CGNA fermented at 37°C and 200rpm for 22h and add 0.01M, PBS, 1.6M sodium pyruvate according to the bacterial addition amount of 15~20OD / mol sodium pyruvate and 30~40OD / mol N-acetylglucosamine , 0.6MN-acetylglucosamine, 0.01M MgCl 2 , 0.4% TritonX-100 whole cell transformation system, OD kept at 30, pH 7.2 ~ 7.4. 30 ℃ 220rpm, sampling at intervals from 0h to 60h, centrifugation to take the supernatant to detect N-acetylneuraminic acid production, detection The yield was 21.89g / L at 50h.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing N-acetylneuraminic acid through recombinant bacillus subtilis whole-cell transformation, and belongs to the field of genetic engineering. Bacillus subtilis serves as an expression host, and recombinant bacillus subtilis genetically engineered bacteria accumulating N-acetylneuraminic acid is obtained through N-acetamide glucose isomerase (AGE) with free plasmid pP43NMK excessively coming from Anabaena sp.CH1 and N-nacetylneuraminic acid aldolase (NanA) coming from Escherichia coli K12; N-acetylglucosamine and sodium pyruvate serve as a substrate for whole-cell transformation, the yield of N-acetylneuraminic acid reaches 21.89 g / L, and a foundation is laid for industrialized production of N-acetylneuraminic acid by using food-safety-level bacillus subtilis.

Description

technical field [0001] The invention relates to a method for producing N-acetylneuraminic acid by whole cell transformation of recombinant Bacillus subtilis, and belongs to the field of genetic engineering. Background technique [0002] N-acetylneuraminic acid is an acidic amino sugar containing 9 carbon atoms and having a pyranose structure. It is the most common and widely distributed sialic acid and serves as a precursor for the biosynthesis of other members of the sialic acid family. N-acetylneuraminic acid is a signaling molecule widely present on the cell surface. There are sialic acid residues at the end of glycoproteins, which determine the macromolecular structure of specific glycoproteins to a certain extent, and participate in cell recognition, signal transduction, etc. multiple physiological processes. N-acetylneuraminic acid can regulate the anti-inflammatory activity of IgG, enhance infant immunity, affect the integrity, permeability and activity of nerve cell...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/75C12P19/26C12R1/125
CPCC12N9/88C12N9/92C12N15/75C12P19/26C12Y401/03003C12Y503/01018
Inventor陈坚堵国成刘延峰李江华赵林
OwnerJIANGNAN UNIV