Method and primers for detecting cell cross-contamination caused by hela cells
A cross-contamination and cell technology, applied in the field of cell cross-contamination primers, can solve problems such as human cell cross-contamination, and achieve the effect of low cost and short time-consuming
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Design, screening, comparison experiment and validation of PCR primers
[0035] The Human papillomavirus-18 sequence (Gene Bank ID: NC_001357) was obtained from the Genbank database of NCBI. According to the PCR primer design principle of molecular biology, 7 PCR upstream primer sequences with higher scores were obtained through bioinformatics calculation screening, and 7 The downstream primer sequences with higher scores are shown in Table 1.
[0036] The primers are artificially synthesized, and these upstream primers and downstream primers are randomly paired, and then PCR experiments and agarose gel electrophoresis are used to screen the primer pairs that can achieve the purpose of the present invention. The screening principle is: exclude primer pairs that cannot be amplified to obtain PCR products, exclude primer pairs that have non-specific amplification, and obtain primer pairs that can efficiently and specifically amplify the target HPV sequence.
[0037] Tabl...
Embodiment 2
[0066] Sensitivity comparison between traditional STR identification method and the method of the present invention
[0067] The mixture of 99% AGS cells + 1% Hela cells, the mixture of 99% HGC-27 cells + 1% Hela cells, the mixture of 99% SNU-216 cells + 1% Hela cells, using the traditional STR identification method, cell purity identification,
[0068] STR identification map such as image 3 As shown, after comparison with the international STR database, it can be seen that the above-mentioned cell lines contaminated by Hela cells with an initial amount of 1% are still wrongly identified as pure products of AGS, HGC-27, and SNU-216 cells.
[0069] In Example 1, when HepG2, AGS, A549, HCT-116, HGC-27, NCI-N87, and SNU-216 cells were mixed with Hela cells, the proportion of Hela cells in the initial culture When it is as low as 1%, the method of the present invention can be used to detect the existence of Hela cells. The results of Example 1 and Example 2 show that when the t...
Embodiment 3
[0071] The method for detecting cell cross-contamination caused by Hela cells based on the primer pair screened by the present invention The primers used in the method include a primer pair of A group and a primer pair of B group, and the sequence of the primer pair of A group is as follows:
[0072] Group A upstream primer: 5'GGTGCCAGAAACCGTTGAATC 3';
[0073] A group of downstream primers: 5'CGTCGGGCTGGTAAATGTTGA 3';
[0074] The sequence of the B group primer pair is as follows:
[0075] Group B upstream primer: 5'CAACCGAGCACGACAGGAA 3';
[0076] Group B downstream primers: 5'ATTGCTCGTGACATAGAAGG 3'.
[0077] 1) Use the supernatant of the cell culture to be tested as the template for the first round of PCR, use the supernatant of the pure culture of Hela cells as the positive control for PCR, and use the primer pair of group A to perform the first round of PCR;
[0078] The reaction system is: 2X Taq Master Mix (CW Biotech, CW0682, China) 12.5 μL, supernatant template 5 ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More