Expression method of VZV glycoprotein to pichia pastoris and application of expression method
An expression method and Pichia pastoris technology, applied in the field of genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0100] Example 1 Expression method using pPink-HC as a vector
[0101] 1. Synthesis of VZV gE gene sequence
[0102] According to the yeast codon preference, the original gE sequence was codon optimized without changing the amino acid sequence to obtain the gene nucleotide sequence SEQ ID NO.1.
[0103] SEQ ID NO.1:
[0104] ATGGGGACAGTTAATAAACCTGTGGTGGGGGTATTGATGGGGTTCGGAATTATCACGGGAACGTTGCGTATAACGAATCCGGTCAGAGCATCCGTCTTGCGATACGATGATTTTCACATCGATGAAGACAAACTGGATACAAACTCCGTATATGAGCCTTACTACCATTCAGATCATGCGGAGTCTTCATGGGTAAATCGGGGAGAGTCTTCGCGAAAAGCGTACGATCATAACTCACCTTATATATGGCCACGTAATGATTATGATGGATTTTTAGAGAACGCACACGAACACCATGGGGTGTATAATCAGGGCCGTGGTATCGATAGCGGGGAACGGTTAATGCAACCCACACAAATGTCTGCACAGGAGGATCTTGGGGACGATACGGGCATCCACGTTATCCCTACGTTAAACGGCGATGACAGACATAAAATTGTAAATGTGGACCAACGTCAATACGGTGACGTGTTTAAAGGAGATCTTAATCCAAAACCCCAAGGCCAAAGACTCATTGAGGTGTCAGTGGAAGAAAATCACCCGTTTACTTTACGCGCACCGATTCAGCGGATTTATGGAGTCCGGTACACCGAGACTTGGAGCTTTTTGCCGTCATTAACCTGTACGGGAGACGCAGCGCCCGCCATCCAGCATATATGCTTAAAACATACAA...
Embodiment 2
[0164] Example 2 Expression method using pGAPZαA as a vector
[0165] 1. Synthesis of VZV gE gene sequence
[0166] According to yeast codon preference, the original gE sequence was codon optimized without changing the amino acid sequence to obtain the full gE gene sequence shown in the gene nucleotide sequence SEQ ID NO.1.
[0167] 2. Design primers
[0168] According to the above-mentioned full sequence of the gE gene and the sequence analysis of the multiple cloning site on the Pichia expression vector pGAPZαA, the primers F1: 5'-GGAATTCATGTCCGTTTTGAGATACGACGAC-3', R1: 5'-CCGCTCGAGTTATCTGATCAATGGGGAAGTA-3' were designed to achieve the two target fragments. Add EcoRI and NotI restriction sites to the ends.
[0169] 3. Construction of recombinant plasmid pGAPZαA-gE
[0170] 3.1 The F1-gE-R1 with the primers connected in step 7 was cloned into the pET28a vector and named pET28a-gE.
[0171] The cloning reaction system is: dd H 2 O 22uL, primerstar 25uL, F1 and R1 each 1.5uL, template 0.2...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap