Unlock instant, AI-driven research and patent intelligence for your innovation.

Expression method of VZV glycoprotein to pichia pastoris and application of expression method

An expression method and Pichia pastoris technology, applied in the field of genetic engineering

Pending Publication Date: 2018-08-10
BRAVOVAX
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the characteristics of the glycoprotein E gene of varicella-zoster virus and the insufficiency of other expression systems, expressing the glycoprotein E gene of varicella-zoster virus with Pichia pastoris expression system can be used as a possible choice and way, but There have been no reports and studies on the successful expression of the varicella-zoster virus glycoprotein E gene in the Pichia pastoris expression system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression method of VZV glycoprotein to pichia pastoris and application of expression method
  • Expression method of VZV glycoprotein to pichia pastoris and application of expression method
  • Expression method of VZV glycoprotein to pichia pastoris and application of expression method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0100] Example 1 Expression method using pPink-HC as a vector

[0101] 1. Synthesis of VZV gE gene sequence

[0102] According to the yeast codon preference, the original gE sequence was codon optimized without changing the amino acid sequence to obtain the gene nucleotide sequence SEQ ID NO.1.

[0103] SEQ ID NO.1:

[0104] ATGGGGACAGTTAATAAACCTGTGGTGGGGGTATTGATGGGGTTCGGAATTATCACGGGAACGTTGCGTATAACGAATCCGGTCAGAGCATCCGTCTTGCGATACGATGATTTTCACATCGATGAAGACAAACTGGATACAAACTCCGTATATGAGCCTTACTACCATTCAGATCATGCGGAGTCTTCATGGGTAAATCGGGGAGAGTCTTCGCGAAAAGCGTACGATCATAACTCACCTTATATATGGCCACGTAATGATTATGATGGATTTTTAGAGAACGCACACGAACACCATGGGGTGTATAATCAGGGCCGTGGTATCGATAGCGGGGAACGGTTAATGCAACCCACACAAATGTCTGCACAGGAGGATCTTGGGGACGATACGGGCATCCACGTTATCCCTACGTTAAACGGCGATGACAGACATAAAATTGTAAATGTGGACCAACGTCAATACGGTGACGTGTTTAAAGGAGATCTTAATCCAAAACCCCAAGGCCAAAGACTCATTGAGGTGTCAGTGGAAGAAAATCACCCGTTTACTTTACGCGCACCGATTCAGCGGATTTATGGAGTCCGGTACACCGAGACTTGGAGCTTTTTGCCGTCATTAACCTGTACGGGAGACGCAGCGCCCGCCATCCAGCATATATGCTTAAAACATACAA...

Embodiment 2

[0164] Example 2 Expression method using pGAPZαA as a vector

[0165] 1. Synthesis of VZV gE gene sequence

[0166] According to yeast codon preference, the original gE sequence was codon optimized without changing the amino acid sequence to obtain the full gE gene sequence shown in the gene nucleotide sequence SEQ ID NO.1.

[0167] 2. Design primers

[0168] According to the above-mentioned full sequence of the gE gene and the sequence analysis of the multiple cloning site on the Pichia expression vector pGAPZαA, the primers F1: 5'-GGAATTCATGTCCGTTTTGAGATACGACGAC-3', R1: 5'-CCGCTCGAGTTATCTGATCAATGGGGAAGTA-3' were designed to achieve the two target fragments. Add EcoRI and NotI restriction sites to the ends.

[0169] 3. Construction of recombinant plasmid pGAPZαA-gE

[0170] 3.1 The F1-gE-R1 with the primers connected in step 7 was cloned into the pET28a vector and named pET28a-gE.

[0171] The cloning reaction system is: dd H 2 O 22uL, primerstar 25uL, F1 and R1 each 1.5uL, template 0.2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses an expression method of VZV glycoprotein to pichia pastoris and application of the expression method. The expression method comprises the following steps: constructing an expression vector, screening a positive transformant, linearizing a yeast expression vector, preparing a yeast electrotransformation competence, identifying a recombinant, expressing recombinant yeast andidentifying target protein. The expression method disclosed by the invention can be used for successfully expressing glycoprotein E of varicella-varicella-zoster virus and the obtained protein has good immunogenicity; the pichia pastoris can be efficiently and stably expressed.

Description

Technical field [0001] The present invention relates to the field of genetic engineering, in particular to a method for expressing VZV (Varicella-Zoster Virus) glycoprotein in Pichia pastoris and its application. Background technique [0002] Varicella-zoster virus (varicella-zoster virus, VZV) is a member of the Herpesviridae alpha herpesvirus subfamily. It is a DNA virus with a diameter of 150 to 200 nm. It is morphologically composed of a nucleic acid core and a protein capsid. It is a symmetrical icosahedron composed of 162 shell particles on the surface. It has the characteristics of skin and nerves. It is a kind of double-stranded DNA virus frequently occurring in young children and the elderly. A fast-onset and highly infectious disease. It can cause two common diseases, chickenpox and herpes zoster, as well as serious complications such as encephalitis and pneumonia. After the patient is cured, a small amount of remaining virus is latent in the nerve cells in the body, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/04C12N15/81A61K39/25A61P31/22
CPCA61K39/12A61P31/22C07K14/005C12N15/815C12N2710/16722C12N2710/16734C12N2800/22
Inventor 肖杨王雨高媛刘昊智毛普加幕婷李津吴克
Owner BRAVOVAX
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More