Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction method for sialidase gene knockout mouse model and application thereof

A gene knockout mouse and sialidase technology, applied in the field of gene editing, can solve the problems of large randomness and low efficiency of integration, and achieve the effects of short experiment period, saving experiment cost, and direct and significant effect

Inactive Publication Date: 2018-09-04
FUZHOU UNIV
View PDF2 Cites 29 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Microinjection technology, microinjection is one of the methods developed earlier for introducing foreign genes into cells to construct transgenic animals, but if foreign DNA fragments are integrated into the host genome through non-homologous recombination, their integration Very random and less efficient

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method for sialidase gene knockout mouse model and application thereof
  • Construction method for sialidase gene knockout mouse model and application thereof
  • Construction method for sialidase gene knockout mouse model and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Construction of Recombinant NPL Knockout CRISPR System Plasmid

[0038] (1) Design of sgRNA

[0039] First, find the genome sequence of the mouse NPL gene through NCBI, and design the sgRNA targeting the NPL gene (sequence is GGTGTCCGCGGCGGAATCCG) on the sgRNA design website of Zhang Feng’s research group http: / / crispr.mit.edu / , and reverse complementation to obtain the reverse strand sequence. Residues after digestion of the BbsI restriction site were added to both ends, and synthesized.

[0040] The two fragments after synthesis are as follows:

[0041] F: CACCG GGTGTCCGCGGCGGAATCCG;

[0042] R: AAAC CGGATTCCGCCGCGGACACC C;

[0043] (2) sgRNA annealing,

[0044] Annealing reaction system:

[0045]

[0046] Mix the prepared liquid evenly, centrifuge briefly and place in a gradient PCR instrument, run the program: 95°C, 10min; 85°C-65°C decreases by 0.1°C per second, 25°C, to form a double-stranded oligonucleotide;

[0047] Positive strand F: CACCGGG...

Embodiment 2

[0061] Example 2 Verification of the knockout vector at the cellular level

[0062] Before using the CRISPR system to knock out the vector for the preparation of knockout mice, it is necessary to verify whether the designed sgRNA is effective, and the knockout verification can be performed in the mouse cell line. Proceed as follows:

[0063] cell transfection

[0064] 1) Take the cells in the logarithmic growth phase and inoculate them in a six-well plate. Establish the experimental group and the control group, and wait for the cell plating rate to reach 75-80%.

[0065] 2) Take two EP tubes, add MEM (50 μl) + lipo3000 (3.75 μl) to tube I, add MEM (50 μl) + DNA (2.5 μg) + P3000 (5 μl) to tube II.

[0066] 3) Add the liquid in II to I, mix well and let it stand for 5 minutes, then add it to a six-well plate and culture it in a cell culture incubator.

[0067] Genome Extraction and Validation

[0068] Primers were designed to amplify about 300 bp at the upper and lower ends...

Embodiment 3

[0075] Fertilized egg retrieval

[0076] (1) Egg donor female mice were intraperitoneally injected with 0.1ml (5U) of pregnant horse serum gonadotropin PMSG, thereby promoting the maturation of female mice's eggs.

[0077] (2) After the injection, the recipient female mouse and the ligated male mouse were caged together, and they were placed in a pseudo-pregnant state through normal mating;

[0078] (3) After pseudopregnancy, female mice were injected with human chorionic gonadotropin hCG 0.1ml (5U), and then mated with normal male mice at a ratio of 1:1.

[0079] (4) On the second day, the donor mice and recipient mice were checked for pregnancy plugs, and the mice with pregnancy plugs were used for fertilized egg collection.

[0080] The specific operation of microinjection is as follows:

[0081] (1) Use the egg transfer device to absorb the fertilized egg cells and place them in the M2 medium on the glass slide;

[0082] (2) Absorb and fix the prepared fertilized eggs w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biotechnologies, and provides a construction method for a sialidase gene knockout mouse model and application thereof. An in vitro and vivo targeted mouse genomeNPL is used for genetically recombining a CRISPR knockout plasmid vector, and a diploid double-knockout NPL mouse knockout model is successfully constructed through an oosperm microinjection technology. The NPL has the important function in a pathophysiological process of a body. Vicious transformation of a cancer cell is always along with overexpression of sialic acid. Now, the overexpression ofthe sialic acid has become one of important markers of the malignant transformation and transferring of a tumor. The model is capable of constructing a new research platform for researching a processof cell canceration, beneficial to a key step of researching generation and transferring of the tumor, and providing a foundation for the research and development of a novel anti-tumor drug.

Description

technical field [0001] The invention belongs to the technical field of gene editing, relates to molecular biology, cell biology, genetics and other research methods, in particular to a method for constructing a sialidase gene knockout mouse model and its application. Background technique [0002] The establishment of gene knockout mouse models has created the possibility for precise research on the relationship between genes and human diseases. Since the birth of genetically modified animals, people have paid great attention to them. With continuous development and improvement in recent years, genetically modified animals have gradually begun to play an extremely important role in many fields. For the entire society, these genetically modified animals Animals have greatly promoted the development of social economy and scientific research. Constructing transgenic animal models, especially gene knockout and knockin animal models, is one of the most intuitive and reliable ways...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85A01K67/027
CPCA01K67/0276A01K2217/075A01K2227/105A01K2267/0331C12N9/2402C12N15/8509C12Y302/01018C12Y302/01129
Inventor 邵敬伟张冰晨
Owner FUZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com