Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

LAMP primers for real-time and quantitative detection of porcine circovirus type 3, kit and application

A porcine circovirus, real-time quantitative technology, applied in the field of microbial detection, can solve the problems of expensive instruments, long time, difficult porcine circovirus, etc., and achieve the effect of rapid acquisition and easy operation.

Inactive Publication Date: 2018-09-14
GUANGXI VETERINARY RES INST
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to provide a simple, quick and accurate quantitative detection of porcine circovirus type 3 LAMP primers, kits and other methods in order to solve the problems of difficulty in laboratory detection and identification of porcine circovirus type 3, time-consuming and expensive instruments. Application, the technical scheme used for realizing the object of the present invention is:

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP primers for real-time and quantitative detection of porcine circovirus type 3, kit and application
  • LAMP primers for real-time and quantitative detection of porcine circovirus type 3, kit and application
  • LAMP primers for real-time and quantitative detection of porcine circovirus type 3, kit and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1 Establishment of a LAMP method for detecting porcine circovirus 3

[0054] 1. Preparation of materials

[0055] Positive materials for porcine circovirus type 3 came from veterinary clinics. After identification by Guangxi Veterinary Research Institute, porcine circovirus type 2, swine fever virus, blue ear virus, pseudorabies virus and mycoplasma suis were all commercially available vaccines. BstDNA polymerase was purchased from Beijing Lanpu Biotechnology Co., Ltd., product number LMP204; virus genome DNA / RNA extraction kit was purchased from Kangwei Century Biotechnology Co., Ltd., product number CW0548.

[0056] 2. Design and synthesis of LAMP primers

[0057] According to the capsid protein coding gene sequence of circovirus type 3 in GenBank, specific LAMP primers were designed, in which F3 and B3 were outer primers, FIP and BIP were inner primers, and LF and LB were loop primers, where

[0058] SEQ ID NO: 1 (PCV3-F3): TCCAGTTTTTTCCGGGACAT

[0059] SE...

Embodiment 2

[0086] The specificity result of embodiment 2 LAMP detection method

[0087] LAMP amplification was performed on 1 strain of porcine circovirus type 3, 5 strains of control virus and water control, and the results were as follows figure 1 As shown, the porcine circovirus type 3 reaction tube showed a rising curve of turbidity in about 12 minutes, which was a positive result, and the 5 strains of control virus reaction tubes and the water control reaction tube had no amplification, which was a negative result.

Embodiment 3

[0088] Example 3 Sensitivity results of LAMP detection method

[0089] The initial concentration of the recombinant plasmid of porcine circovirus type 3 was 4.39×10 ng / μL, and 8 dilutions were serially diluted 10 times with RNA-Free Water, and 2 μL of each dilution was used as a template. The results were as follows figure 2 and image 3 As shown, the result shows that the detection limit of the LAMP method of the present invention is about 4.39 × 10 -4 ng / μL, while the detection limit of common PCR method is 4.39×10 -2 ng / μL.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses LAMP primers for real-time and quantitative detection of porcine circovirus type 3, a kit and application. The primers are as shown in SEQ ID NO:1-6. The kit comprises the LAMPprimers, a 2*reaction buffer solution, Bst DNA polymerase, ultra-pure water and a porcine circovirus type 3 DNA template. The application includes sample preparation, design and synthesis of the LAMPprimers, extraction of viral genome DNA templates, establishment of an LAMP reaction system, and specificity detection, sensibility detection and real-time and quantitative detection performed by adopting an LAMP detection method. The specificity detection and the sensibility detection prove that the LAMP detection method provided by the invention can monitor the reaction in real time and can quantitatively detect the copy number of the porcine circovirus type 3, and detection results can be quickly and accurately obtained, thereby bringing convenience for simply, conveniently and quickly detecting the porcine circovirus type 3.

Description

technical field [0001] The invention relates to the technical field of microbial detection, in particular to a rapid, visualized and real-time quantitative detection of porcine circovirus type 3 ring-mediated isothermal amplification kit and its application. Background technique [0002] Circoviruses (PCVs) belong to the Circoviridae family and are the smallest known vertebrate viruses. Pigs are the main host of circovirus, and pigs of all ages have strong susceptibility to circovirus. Pigs infected during the embryonic period or early postnatal period often develop the disease after weaning, generally concentrated at the age of 5 to 18 weeks, especially at the age of 6 to 12 weeks. Pregnant sows infected with circovirus lead to reproductive impairment and can be vertically transmitted to piglets through the placenta. Infected pigs can excrete the virus from nasal fluid, feces and other excreta, and cause infection through the digestive tract and respiratory tract. The in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/6844C12Q1/6851C12N15/11C12R1/93
CPCC12Q1/6844C12Q1/6851C12Q1/701C12Q2531/119C12Q2545/114
Inventor 李军潘艳吴翠兰彭昊冯世文贺会利钟舒红胡帅李常挺马春霞谢永平
Owner GUANGXI VETERINARY RES INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com