LAMP primers for real-time and quantitative detection of porcine circovirus type 3, kit and application
A porcine circovirus, real-time quantitative technology, applied in the field of microbial detection, can solve the problems of expensive instruments, long time, difficult porcine circovirus, etc., and achieve the effect of rapid acquisition and easy operation.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Example 1 Establishment of a LAMP method for detecting porcine circovirus 3
[0054] 1. Preparation of materials
[0055] Positive materials for porcine circovirus type 3 came from veterinary clinics. After identification by Guangxi Veterinary Research Institute, porcine circovirus type 2, swine fever virus, blue ear virus, pseudorabies virus and mycoplasma suis were all commercially available vaccines. BstDNA polymerase was purchased from Beijing Lanpu Biotechnology Co., Ltd., product number LMP204; virus genome DNA / RNA extraction kit was purchased from Kangwei Century Biotechnology Co., Ltd., product number CW0548.
[0056] 2. Design and synthesis of LAMP primers
[0057] According to the capsid protein coding gene sequence of circovirus type 3 in GenBank, specific LAMP primers were designed, in which F3 and B3 were outer primers, FIP and BIP were inner primers, and LF and LB were loop primers, where
[0058] SEQ ID NO: 1 (PCV3-F3): TCCAGTTTTTTCCGGGACAT
[0059] SE...
Embodiment 2
[0086] The specificity result of embodiment 2 LAMP detection method
[0087] LAMP amplification was performed on 1 strain of porcine circovirus type 3, 5 strains of control virus and water control, and the results were as follows figure 1 As shown, the porcine circovirus type 3 reaction tube showed a rising curve of turbidity in about 12 minutes, which was a positive result, and the 5 strains of control virus reaction tubes and the water control reaction tube had no amplification, which was a negative result.
Embodiment 3
[0088] Example 3 Sensitivity results of LAMP detection method
[0089] The initial concentration of the recombinant plasmid of porcine circovirus type 3 was 4.39×10 ng / μL, and 8 dilutions were serially diluted 10 times with RNA-Free Water, and 2 μL of each dilution was used as a template. The results were as follows figure 2 and image 3 As shown, the result shows that the detection limit of the LAMP method of the present invention is about 4.39 × 10 -4 ng / μL, while the detection limit of common PCR method is 4.39×10 -2 ng / μL.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com