Constitutive-inductive type yeast engineering bacteria and construction method thereof

A yeast engineering and construction method technology, applied in the field of genetic engineering, can solve the problems of underutilization of molecular directional breeding technology, backward fermentation level, late start of research and development of mesothermal α-amylase, etc., so as to improve fermentation activity and improve expression level. , the effect of large application advantages

Pending Publication Date: 2018-09-28
CENT SOUTH UNIV
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The research and development of mesophilic α-amylase in my country started late, and most of the production strains were obtained by purchasing foreign technology or adopting traditional breeding technology. Modern molecular directional breeding technology has not been fully utilized, and the fermentation level lags behind that of European and American countries
In recent years, genetic engineering methods have been used at home and abroad to improve the expression level of mesophilic α-amylase, such as Chinese invention patent 201110006353.9, but the constitutive and inducible expression cassettes are connected in series to construct high-efficiency expression of mesophilic α-amylase through one transformation and single resistance screening. Pichia genetically engineered strains of amylase have not been reported yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Constitutive-inductive type yeast engineering bacteria and construction method thereof
  • Constitutive-inductive type yeast engineering bacteria and construction method thereof
  • Constitutive-inductive type yeast engineering bacteria and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Embodiment 1, the acquisition of β-mannanase and its coding gene

[0046] The β-mannanase in the present invention is a modified sequence of β-mannanase derived from the fungus Aspergillus sp.T16. For the amino acid sequence of the enzyme and its corresponding coding gene sequence, refer to Chinese invention patent CN201310190483.1.

[0047] The coding gene sequence corresponding to the β-mannanase in the present invention is shown as SEQ ID No.1. The abbreviations of various amino acids and bases in the sequence of the present invention are shown in Table 1. The amino acids at positions 34, 55 and 129 in the amino acid sequence of β-mannanase are aliphatic amino acids, that is, at positions 34, 55 and 129. Xaa can be A, G, I, L or V; amino acids at positions 101, 170 and 204 are charged amino acids, that is, Xaa at positions 101, 170 and 204 can be D, E, R, K or H; Amino acids at positions 54, 56, 112 and 306 are aromatic amino acids, that is, Xaa at positions 54, 56,...

Embodiment 2

[0050] Embodiment 2, construction of constitutive or inducible yeast genetically engineered bacteria expressing β-mannanase

[0051] Using the β-mannanase gene man modified in Chinese invention patent CN201310190483.1 as a template, and ManF-5CCGCTCGAGAAAAGAGAGGCTGAAGCTTCCTTCGCCAGCACCTCCGG3 and ManR-5GCTCTAGATCAAGCACTACCAATAGCAGCAACATG3 as primers, PCR amplification was performed. The PCR amplification parameters were: denaturation at 95°C for 5 minutes; 94 Denaturation at ℃ for 1min, annealing at 52℃ for 1min, extension at 72℃ for 2min, 30 cycles; full extension at 72℃ for 15min. The pGAPZαA and pPICZZαA plasmids were double-digested with Xho I and Xba I, and the above PCR product was double-digested at the same time, and the double-digested PCR product was ligated with the purified product of the double-digested plasmid with T4 ligase. The ligation product was transferred into E.coli DH5α by the heat shock method, and positive clones were picked for PCR identification and se...

Embodiment 3

[0054] Example 3, Construction of constitutive and inducible yeast genetically engineered bacteria co-expressing β-mannanase

[0055] 1. Construction of β-mannanase constitutive and inducible co-expression vectors

[0056] Extract the correctly constructed constitutive plasmid pGAPZα-man and the inducible plasmid pPICZα-man in Example 2, linearize pGAPZα-man with restriction endonuclease BamHI and endonuclease NcoI, BglП and endonuclease NcoI linearize pPICZα- man( figure 2 ); the fragment containing the β-mannanase gene in the above linearized product was recovered by agarose gel electrophoresis, and the above two fragments were connected with T4 ligase, named pGAPZα-man-pPICZα-man; the ligated product Transform Escherichia coli by the heat shock method, and pick positive clones for PCR identification and sequencing.

[0057] 2. Construction of β-mannanase constitutive and inducible co-expression yeast genetically engineered bacteria

[0058] The above-mentioned plasmid p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses constitutive-inductive type yeast engineering bacteria and construction method thereof. The method includes steps of: connecting a constitutive expression cassette and an inductive expression cassette, which simultaneously include protein genes requiring expression, in series and leading the expression cassettes into a yeast host cell; performing antibiotics screening justfor one time to obtain the yeast engineering bacteria simultaneously having constitutive and inductive expression. For an example of expression of beta-mannase, compared with engineering bacteria in single constitutive or inductive expression for expression of the beta-mannase, the constitutive-inductive type yeast engineering bacteria is significantly improved in fermentation activity of the beta-mannase. The method is simple in operation and can be used for increasing expression level of other heterologous proteins in yeast engineering bacteria.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and the invention relates to yeast genetically engineered bacteria capable of constitutively and inducibly expressing proteins or polypeptides and a construction method thereof. Background technique [0002] The expression system of Pichia pastoris is widely used for the expression of heterologous proteins. Among them, the constitutive expression initiated by the GAP promoter and the inducible expression initiated by the AOX1 promoter are the most widely used, and the combination of the two can greatly improve the expression of heterologous proteins. protein expression level. Through extensive review of domestic and foreign literature and patents, it is found that the construction of constitutive and inducible co-expressed Pichia genetically engineered bacteria is all through two transformations, two screenings and double resistance screening (J.M.Wu, et al., Enzyme and Microbial Technology, 3...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/19C12N15/81C12N15/56C12R1/84
CPCC12N9/2494C12N9/2414C12N15/815C12N2830/002C12Y302/01001C12Y302/01078
Inventor周洪波唐诗哲郑甲程海娜徐挺亮周凯燕
OwnerCENT SOUTH UNIV