Constitutive-inductive type yeast engineering bacteria and construction method thereof

A yeast engineering and construction method technology, applied in the field of genetic engineering, can solve the problems of underutilization of molecular directional breeding technology, backward fermentation level, late start of research and development of mesothermal α-amylase, etc., so as to improve fermentation activity and improve expression level. , the effect of large application advantages

Pending Publication Date: 2018-09-28
CENT SOUTH UNIV
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The research and development of mesophilic α-amylase in my country started late, and most of the production strains were obtained by purchasing foreign technology or adopting traditional breeding technology. Modern molecular directional breeding technology has not been fully utilized, and the fermentation level lags behind that of European and American countries
In recent years, genetic engineering methods have

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Constitutive-inductive type yeast engineering bacteria and construction method thereof
  • Constitutive-inductive type yeast engineering bacteria and construction method thereof
  • Constitutive-inductive type yeast engineering bacteria and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0045] Example 1. Obtaining β-mannanase and its coding gene

[0046] The β-mannanase in the present invention is a modified sequence of β-mannanase derived from the fungus Aspergillus sp. T16. For the amino acid sequence of the enzyme and its corresponding coding gene sequence, please refer to the Chinese invention patent CN201310190483.1.

[0047] The coding gene sequence corresponding to β-mannanase in the present invention is as SEQ ID No. 1. The abbreviations of various amino acids and bases in the sequence of the present invention are shown in Table 1. The amino acids at positions 34, 55 and 129 in the amino acid sequence of β-mannanase are aliphatic amino acids, that is, the amino acids at positions 34, 55 and 129. Xaa can be A, G, I, L or V; the amino acids at positions 101, 170 and 204 are charged amino acids, that is, Xaa at positions 101, 170 and 204 can be D, E, R, K or H; The amino acids at positions 54, 56, 112, and 306 are aromatic amino acids, that is, Xaa at positi...

Example Embodiment

[0050] Example 2. Construction of yeast genetically engineered bacteria expressing β-mannanase in constitutive or inducible form

[0051] Using the β-mannanase gene man modified in the Chinese invention patent CN201310190483.1 as a template, and ManF-5CCGCTCGAGAAAAGAGAGGCTGAAGCTTCCTTCGCCAGCACCTCCGG3 and ManR-5GCTCTAGATCAAGCACTACCAATAGCAGCAACATG3 as primers, PCR amplification was carried out, and the PCR amplification parameters were: 95℃ denaturation 5min; Denaturation at ℃ for 1 min, annealing at 52 ℃ for 1 min, extension at 72 ℃ for 2 min, 30 cycles; full extension at 72 ℃ for 15 min. The pGAPZαA and pPICZZαA plasmids were double digested with Xho I and Xba I, and the PCR product was double digested at the same time, and the double digested PCR product was ligated with the purified product of the double digested plasmid with T4 ligase. The ligation product was transferred into E.coli DH5α by heat shock method, and the positive clone colonies were selected for PCR identification...

Example Embodiment

[0054] Example 3. Construction of yeast genetically engineered strains co-expressing β-mannanase constitutively and inducibly

[0055] 1. The construction of β-mannanase constitutive and inducible co-expression vector

[0056] The constitutive plasmid pGAPZα-man and the inducible plasmid pPICZα-man constructed correctly in Example 2 were extracted, and pGAPZα-man was linearized with restriction endonuclease BamHI and endonuclease NcoI, and pPICZα-man was linearized with BglП and endonuclease NcoI. man( figure 2 ); Recover the fragments containing the β-mannase gene in the linearized product through agarose gel electrophoresis, and connect the two fragments with T4 ligase, named pGAPZα-man-pPICZα-man; Transfer to Escherichia coli by heat shock method, pick out the positive clone colonies PCR identification and sequencing.

[0057] 2. Construction of constitutive and inducible co-expression of β-mannanase gene engineering bacteria

[0058] The above plasmid pGAPZα-man-pPICZα-man was e...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses constitutive-inductive type yeast engineering bacteria and construction method thereof. The method includes steps of: connecting a constitutive expression cassette and an inductive expression cassette, which simultaneously include protein genes requiring expression, in series and leading the expression cassettes into a yeast host cell; performing antibiotics screening justfor one time to obtain the yeast engineering bacteria simultaneously having constitutive and inductive expression. For an example of expression of beta-mannase, compared with engineering bacteria in single constitutive or inductive expression for expression of the beta-mannase, the constitutive-inductive type yeast engineering bacteria is significantly improved in fermentation activity of the beta-mannase. The method is simple in operation and can be used for increasing expression level of other heterologous proteins in yeast engineering bacteria.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and the invention relates to yeast genetically engineered bacteria capable of constitutively and inducibly expressing proteins or polypeptides and a construction method thereof. Background technique [0002] The expression system of Pichia pastoris is widely used for the expression of heterologous proteins. Among them, the constitutive expression initiated by the GAP promoter and the inducible expression initiated by the AOX1 promoter are the most widely used, and the combination of the two can greatly improve the expression of heterologous proteins. protein expression level. Through extensive review of domestic and foreign literature and patents, it is found that the construction of constitutive and inducible co-expressed Pichia genetically engineered bacteria is all through two transformations, two screenings and double resistance screening (J.M.Wu, et al., Enzyme and Microbial Technology, 3...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N1/19C12N15/81C12N15/56C12R1/84
CPCC12N9/2494C12N9/2414C12N15/815C12N2830/002C12Y302/01001C12Y302/01078
Inventor 周洪波唐诗哲郑甲程海娜徐挺亮周凯燕
Owner CENT SOUTH UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap