Biological recombinant miR124-3p capable of effectively suppressing osteosarcoma growth

A recombinant, recombinant plasmid technology, applied in the field of genetic engineering, can solve problems such as side effects and limitations, and achieve the effects of high yield, low cost, and efficient aggregation

Active Publication Date: 2018-12-18
ZHONGNAN HOSPITAL OF WUHAN UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] With the deepening of non-coding RNA research and understanding, the important role of miRNA molecules in new cancer treatment schemes is becoming more and more obvious. By referring to a large number of literatures, we can clearly find that no matter what Whether it is in the laboratory research stage or in the clinical practice, the vast majority of miRNAs used by researchers are artificially synthesized, while the miRNA reagents obtained by other methods are very small and very limited.
As we all know, miRNAs synthesized by artificial chemical methods need to undergo a large number of special artificial group modifications to ensure the stability of their structures and biological functions. However, as manufacturers add artificial chemical groups of different structures to miRNA analogs, , the side effects of these artificial groups themselves also appear, and how much these artificial modification groups can specifically bring to the biological characteristics of miRNA itself, such as the multidimensional structure, physical and chemical properties, biological activity and biological safety of miRNA, etc. At present, there is no suitable method and effective way to accurately detect and express the influence and change. Therefore, these artificially modified chemical groups will definitely have a non-negligible impact on researchers in the process of studying miRNA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Biological recombinant miR124-3p capable of effectively suppressing osteosarcoma growth
  • Biological recombinant miR124-3p capable of effectively suppressing osteosarcoma growth
  • Biological recombinant miR124-3p capable of effectively suppressing osteosarcoma growth

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0041] 【Example 1】Expressible htRNA Leu / miR124-3p and its positive control htRNA Leu Construction and amplification of recombinant plasmids

[0042] 1. htRNA Leu / miR124-3p and its positive control htRNA Leu Secondary Structure Design

[0043] Utilization of human-derived leucine (Leu)-carrying tRNA as htRNA Leu / miR124-3p main structure, design prediction of its secondary structure (such as figure 1 B) Through the professional RNA secondary structure design website: http: / / rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi Sure. htRNA Leu / miR124-3p的碱基序列为:ACCAGGAUGGCCGAGUGGUUAAGGCGUUGGACUGGCCAGCUGUGAGUGUUUCUUUAAGGCACGCGGUGAAUGCCGUUGUGAGCAAUAGUAAGGAAGCGGUGUUCCCGUCGUGCCUUCUAGAAGUGCUGCACGUUGUUGGCCCGAUCCAAUGGACAUAUGUCCGCGUGGGUUCGAACCCCACUCCUGGUACCA。 positive control htRNA Leu The secondary structure of is designed in the same way (such as figure 1 A), its base sequence is: ACCAGGAUGGCCGAGUGGUUAAGGCGUUGGACUAGUAAUUUACGUCGACGGUGACGUCGAUGGUUGCGGGAUCCAAUGGACAUAUGUCC...

example 2

[0079] 【Example 2】htRNA Leu / miR124-3p and its positive control htRNA Leu purification of

[0080] The filtered total RNA solution was purified using NGC Quest 10Plus fast protein liquid chromatography (FPLC) system (anion exchange column model and specification: ENrichTM Q 10×100), htRNA Leu / miR124-3p or its positive control htRNA Leu to separate (e.g. figure 2 B), the specific steps are as follows:

[0081] 1. Balance the ion exchange column, use 100% buffer A (10nM sodium phosphate, pH=7.0) to balance 2 volumes of ENrichTM Q 10×100 anion exchange column at a flow rate of 4.0ml / min;

[0082] 2. To elute the ion exchange column, use buffer B (10nM sodium phosphate + 1M sodium chloride, pH=7.0) with a gradient concentration of 0-55% to elute at a flow rate of 4.0ml / min for 30s, and then add buffer B The concentration of the solution was maintained at 55% for 2mins, and then the buffer B was increased from 55% to 65% for 10mins;

[0083] 3. Collection of htRNA Leu / miR...

example 3

[0096] 【Example 3】htRNA Leu / miR124-3p and its positive control htRNA Leu Purity analysis

[0097] htRNA Leu / miR124-3p and its positive control htRNA Leu The purity of the Shimadzu LC-20AD high-performance liquid chromatography system is used for analysis (such as image 3 B), the chromatographic column model and specifications are: XBridge OST C18, 2.5μm, 10×50m, the buffer flow rate is 0.2ml / min, the column temperature is kept at 60°C, and the buffer A is: 8.6mM TEA and 100mM hexafluoroiso Aqueous propanol (pH=8.3), buffer B: 8.6 mM TEA and 100 mM hexafluoroisopropanol in methanol (pH=8.3).

[0098] 1.16% buffer B was passed through the column for 1min;

[0099] 2.22% buffer B was passed through the column for 1min;

[0100] 3. Photodiode array detector detects htRNA at 260nm Leu / miR124-3p or its positive control htRNA Leu waveform;

[0101] 4. Evaluation of final htRNA using peak area calculation Leu / miR124-3p and its positive control htRNA Leu Purity, the pur...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Biological recombinant miR124-3p capable of effectively suppressing osteosarcoma growth is disclosed and has a nucleotide sequence shown as SEQ ID NO:1. A base sequence capable of expressing mature miR124-3p is inserted from an anticodon in the base sequence of human-derived tRNA adopted as a carrier skeleton, then the synthesized structure is transferred into common E. coli through a plasmid, andafter about 12 h of incubation, a target recombinant miRNA is subjected to separation, purification and desalting treatment to obtain the recombinant miRNA that can be put into use directly. Under the premise of ensuring a high yield and high purity, the whole preparation process adopts natural organisms as media, and original biological characteristics of natural miR124-3p in cells are preservedwith extremely high fidelity, and therefore, the miR124-3p is safer, stabler and more natural than miRNA analogues artificially chemically synthesized.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and relates to a novel recombinant miR124-3p, i.e. htRNA, which can be constructed and produced on a large scale by genetic engineering methods Leu / miR124-3p. Background technique [0002] Osteosarcoma (OS) is the most common primary sarcoma in children and adolescents, and the incidence rate of males is higher than that of females, with a ratio of about 2:1. From an anatomical point of view, the most common sites of osteosarcoma are the proximal end of the distal femur, tibia, and humerus, and about 50% to 70% of all patients occur around the knee joint. At present, in clinic, the main treatment for osteosarcoma is neoadjuvant chemotherapy---resection of local tumor tissue by surgery---maintenance of chemotherapeutic drugs. It has greatly reduced the amputation rate of patients with affected limbs, and significantly increased the five-year survival rate of patients from about 20% ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/70C12N15/10A61K48/00A61K31/7088A61P35/00
CPCA61K31/7088A61P35/00C12N15/1003C12N15/113C12N15/70
Inventor喻爱喜李鹏程简超
OwnerZHONGNAN HOSPITAL OF WUHAN UNIV