A kind of preparation method of transgenic chicken oviduct bioreactor
A bioreactor, transgenic chicken technology, applied in the field of genetic engineering, can solve problems such as double-strand mutation, and achieve the effects of simple operation, short cycle and improved accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0033] A kind of preparation method of transgenic chicken oviduct bioreactor of the present invention comprises the following steps:
[0034] S1. Design gRNA targeting chicken genomic DNA: the selected chicken genome target DNA sequence is the first intron of ovalbumin, the sequence is shown in SEQ.1, according to the different PAM sequence rules of different types of Cas9 proteins, select homology More than 90% gRNA;
[0035] 5'-CTCAAAAGGTAAGCAACTCTCTGGAATTACCTTCTCTCTATATTAGCTCTTACTTGCACCTAAACTTTAAAAAATTAACAATTATTGTGTTATGTGTTGTATCTTTAAGGGTGAAGTACCTGCGTGATACCCCCTATAAAAACTTCTCACCTGTGTATGCATTCTGCACTATTTTATTATGTGTAAAAGCTTTGTGTTTGTTTTCAGGAGGCTTATTCTTTGTGCTTAAAATATGTTTTTAATTTCAGAACATCTTATCCTGTCGTTCACTATCTGATATGCTTTGCAGTTTGCCTGATTAACTTCTAGCCCTACAGAGTGCACAGAGAGCAAAATCATGGTGTTCAGTGAATTCTGGGGAGTTATTTTAATGTGAAAATTCTCTAGAAGTTTAATTCCTGCAAAGTGCAGCTGCTGATCACTACACAAGATAAAAATGTGGGGGGTGCATAAACGTATATTCTTACAATAATAGATACATGTGAACTTGTATACAGAAAAGAAAATGAGAAAAATGTGTGTGCGTATACTCACACACGTGGTCAGTAAAAACTTTTG...
Embodiment 1
[0047] When the PAM type is 5'-NNN-3', SpCas9 derived from Streptococcus pyogenes is commonly used. The PAM rule is 5'-NGG-3'. SpCas9 generates 65 target site sequences in the target DNA sequence, as shown in Table 1. .
[0048] Table 1 The target site sequence of SpCas9 in the target DNA sequence
[0049]
[0050]
[0051] With the sequence TGTGCGTATACTCACACACG TGG For example, where TGG is the PAM sequence, and TGTGCGTATACTCACACACG is the target site sequence.
[0052](1) Use the pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid as a vector (Addgene plasma ID: 42230, hereinafter referred to as pX330), which can express gRNA and SpCas9 protein at the same time, digest 1ug pX330 plasmid with 1uL BbsI, and incubate at 37°C for 1 Hours later, 1% agarose electrophoresis was used to recover the digested fragment (QIAquick Gel Extraction Kit recovery kit), and the enzyme digestion reaction system was as follows:
[0053]
[0054] According to the selected target site sequence...
Embodiment 2
[0075] The human albumin gene was used as the exogenous gene to construct the donor plasmid.
[0076] 1. Construct a homologous repair donor plasmid. The homologous donor DNA is sequentially connected by the upstream homology arm, the exogenous gene expression frame and the downstream homology arm. The exogenous gene expression frame includes a first intron sequence to complete the first intron sequence of the ovalbumin gene. An intron sequence; human serum albumin ALB gene, the original signal peptide is removed, and chicken lysozyme signal peptide is added. A BGHpolyA sequence that protects the mRNA structure.
[0077] (1). Single-stranded DNA is used as the template for homologous recombination repair. The upstream 90bp of the genome break site is used as the upstream homology arm, and the downstream 90bp is used as the downstream homology arm. The antisense strand is used as the template for artificial synthesis. The schematic diagram of the operation is shown in the figu...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



