Primer combination and method for detecting human embryo Chediak-Higashi syndrome LYST gene mutation
A primer combination and syndrome technology, applied in biochemical equipment and methods, recombinant DNA technology, microbial assay/inspection, etc., can solve problems such as contamination, amplification failure, allele tripping, etc., and achieve accurate detection results. , the detection process is fast and the cost is low
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0086] Example 1: Pre-implantation diagnosis of LYST gene mutation in 4 embryos with Chediak-Higashi syndrome based on the Ion Torrent sequencing platform
[0087] This embodiment adopts the following reagents: 5×Ion Ampliseq TM HiFi Master Mix (Life Company), 2 x Ion Ampliseq TM Primer Pool (Life), FuPa Reagent (Life), Ion P1 Adapter and Ion Xpress TM Barcode X (Life Corporation), Switch Solution (Life Corporation), DNA Ligase (Life Corporation), XP Reagent (Beckman Corporation), Platium TM PCR SuperMix High Fidelity (Life Company), Library Amplification Primer Mix (Life Company), Nuclease-FreeWater, absolute ethanol.
[0088] Before the experiment of this method, a reagent needs to be freshly prepared: 75% ethanol.
[0089] Instruments and equipment needed for this experiment: centrifuge, magnetic stand, pipette, PCR instrument, oscillator, fluorometer Qubit 4.0.
[0090] Main experimental steps:
[0091] (1) Sample source: a couple carrying LYST mutation gene, f...
Embodiment 2
[0184] Embodiment 2: Sanger generation sequencing verification of embodiment 1
[0185] 1. Nested PCR amplification:
[0186] 1. Sample:
[0187] 1.1 8 WGA samples: No. 1~8
[0188] 1.2 2 whole blood DNA samples of parents: M (mother), F (father)
[0189] 2. There are 2 sets of 3 pairs of PCR primers:
[0190] 2.1 Primer A composition: ① G1-5Fa: GAGGTTCAGGAAGATTTTGTG, G1-5Ra:
[0191]
[0192] 2.2 Primer B composition: ②G1-3Fa: CAGCTGATAATGACCCAAGAA, G1-3Ra:
[0193] ACTGGAAATGTTTCAAAGGAA---650bp; ③G1-3F: AGGCAGGAGAATGGTGTGAAC, G1-3R: GCAATCATAGCTCACTCACCG---356bp
[0194] 3.PCR method:
[0195] 3.1 Primer A for ordinary PCR, that is, use primer ① to perform PCR amplification according to the following PCR reaction system / conditions
[0196] 3.2 Primer B for nested PCR, that is, first use primer ② to perform PCR amplification according to the following PCR reaction system / conditions, and then
[0197] Dilute the PCR product 10,000 times, and use primer ③ to carry ou...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com