Methods for prokaryotic expression, eukaryotic expression, purification and monoclonal antibody preparation of V protein of peste des petits ruminants
A technology of Peste des petits ruminants and protein, applied in the direction of immunoglobulin, chemical instruments and methods, antiviral immunoglobulin, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0181] 1. Preparation of feeder cells
[0182] One day before the fusion, a 7-week-old Balb / c female mouse was killed by cervical dislocation, soaked in 75% alcohol for 5 minutes, fixed on the shelf, moved into the ultra-clean table, and lifted the abdominal skin of the mouse with tweezers. Bacteria cut the abdominal skin (be careful not to damage the peritoneum), and peel it off with forceps to fully expose the peritoneum. Use a disposable sterile syringe to draw 10 mL of basic culture solution into the abdominal cavity of the mouse, fix the syringe with the right hand and keep it still, use the left hand to grasp the alcohol cotton ball with tweezers and gently rub the mouse abdomen for 2-3 minutes, and then use the syringe to suck out the culture medium in the abdominal cavity Liquid (containing macrophages) was injected into a sterilized plate. Take 50mL of 20% complete culture solution (including HAT), and add it to five 96-well cell culture plates with a multichannel pi...
Embodiment 1
[0200] Example 1 Monoclonal Antibody Synthesis and Preparation of Peptide from a Fragment of Peste des Petits Ruminants V Gene (Known Sequence)
[0201] The detailed steps are as follows:
[0202] (1) The sequence and concentration of the peptide
[0203] Polypeptide sequence: GGATCAGACAAAGTCGACATGTCTCCTGAAGATAATCTCGGATTT, located between 207bp-252bp of V gene; encoded amino acid: GSDKVDMSPEDNLGF. The peptide was synthesized by Guangzhou Luofu Biotechnology Co., Ltd. and coupled with -KLH at a concentration of 1 mg / ml.
[0204] (2) Immunization of mice
[0205] The polypeptide was mixed with 0.1 mg / mL and Freund's complete adjuvant in equal volume, and 7-week-old Balb / c female mice were selected, and 0.2 mL was injected intraperitoneally; on the 14th and 28th days, respectively, the emulsified antigen was boosted with Freund's incomplete adjuvant Immunization (the immunization site and method are the same as the first immunization), blood was collected by docking the tail o...
Embodiment 2
[0216] Example 2 Eukaryotic expression of Peste des petits ruminants V protein
[0217] (1) Primer design
[0218] Based on the eukaryotic expression vector pFastBac TM The enzyme cutting sites on the Dual (preserved in our laboratory) and the enzyme cutting sites of the V gene sequence were analyzed using DNAStar software, and the enzyme cutting sites of the upstream and downstream primers were designed as EcoRI and HindIII, respectively. The HA tag is added to the downstream primer, the HA sequence is: TACCCATACGACGTCCCAGACTACGCT, and the reverse transcription sequence of the HA tag is: AGC GTA GTC TGG GAC GTC GTA TGG GTA. upstream primer
[0219] P1: AACC GAATTC ATGGCAGAAGAACAAGCATACCAT; downstream primer plus HA tag as follows,
[0220] B2: ATTT AAGCTT TTAAGCGTAGTCTGGGACGTCGTATGGGTAGGCTGAGTCAGTGATGC.
[0221] Mutation Primer M1:
[0222] Mutation Primer M2: The bases in the box are the mutation points of the V gene. Primers were synthesized by Shanghai Bioengi...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com