Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Methods for prokaryotic expression, eukaryotic expression, purification and monoclonal antibody preparation of V protein of peste des petits ruminants

A technology of Peste des petits ruminants and protein, applied in the direction of immunoglobulin, chemical instruments and methods, antiviral immunoglobulin, etc.

Inactive Publication Date: 2019-01-04
VETERINARY INST XINJINAG ACADEMY OF ANIMAL SCI CLINIC MEDICAL SCI RES CENT XINJIANG ACADEMY OF ANIMAL HUSBANDRY SCI
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In the prior art, there is no related report on prokaryotic and eukaryotic expression, purification and monoclonal antibody preparation of a kind of Peste des petits ruminants V protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methods for prokaryotic expression, eukaryotic expression, purification and monoclonal antibody preparation of V protein of peste des petits ruminants
  • Methods for prokaryotic expression, eukaryotic expression, purification and monoclonal antibody preparation of V protein of peste des petits ruminants
  • Methods for prokaryotic expression, eukaryotic expression, purification and monoclonal antibody preparation of V protein of peste des petits ruminants

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0181] 1. Preparation of feeder cells

[0182] One day before the fusion, a 7-week-old Balb / c female mouse was killed by cervical dislocation, soaked in 75% alcohol for 5 minutes, fixed on the shelf, moved into the ultra-clean table, and lifted the abdominal skin of the mouse with tweezers. Bacteria cut the abdominal skin (be careful not to damage the peritoneum), and peel it off with forceps to fully expose the peritoneum. Use a disposable sterile syringe to draw 10 mL of basic culture solution into the abdominal cavity of the mouse, fix the syringe with the right hand and keep it still, use the left hand to grasp the alcohol cotton ball with tweezers and gently rub the mouse abdomen for 2-3 minutes, and then use the syringe to suck out the culture medium in the abdominal cavity Liquid (containing macrophages) was injected into a sterilized plate. Take 50mL of 20% complete culture solution (including HAT), and add it to five 96-well cell culture plates with a multichannel pi...

Embodiment 1

[0200] Example 1 Monoclonal Antibody Synthesis and Preparation of Peptide from a Fragment of Peste des Petits Ruminants V Gene (Known Sequence)

[0201] The detailed steps are as follows:

[0202] (1) The sequence and concentration of the peptide

[0203] Polypeptide sequence: GGATCAGACAAAGTCGACATGTCTCCTGAAGATAATCTCGGATTT, located between 207bp-252bp of V gene; encoded amino acid: GSDKVDMSPEDNLGF. The peptide was synthesized by Guangzhou Luofu Biotechnology Co., Ltd. and coupled with -KLH at a concentration of 1 mg / ml.

[0204] (2) Immunization of mice

[0205] The polypeptide was mixed with 0.1 mg / mL and Freund's complete adjuvant in equal volume, and 7-week-old Balb / c female mice were selected, and 0.2 mL was injected intraperitoneally; on the 14th and 28th days, respectively, the emulsified antigen was boosted with Freund's incomplete adjuvant Immunization (the immunization site and method are the same as the first immunization), blood was collected by docking the tail o...

Embodiment 2

[0216] Example 2 Eukaryotic expression of Peste des petits ruminants V protein

[0217] (1) Primer design

[0218] Based on the eukaryotic expression vector pFastBac TM The enzyme cutting sites on the Dual (preserved in our laboratory) and the enzyme cutting sites of the V gene sequence were analyzed using DNAStar software, and the enzyme cutting sites of the upstream and downstream primers were designed as EcoRI and HindIII, respectively. The HA tag is added to the downstream primer, the HA sequence is: TACCCATACGACGTCCCAGACTACGCT, and the reverse transcription sequence of the HA tag is: AGC GTA GTC TGG GAC GTC GTA TGG GTA. upstream primer

[0219] P1: AACC GAATTC ATGGCAGAAGAACAAGCATACCAT; downstream primer plus HA tag as follows,

[0220] B2: ATTT AAGCTT TTAAGCGTAGTCTGGGACGTCGTATGGGTAGGCTGAGTCAGTGATGC.

[0221] Mutation Primer M1:

[0222] Mutation Primer M2: The bases in the box are the mutation points of the V gene. Primers were synthesized by Shanghai Bioengi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses methods for prokaryotic expression, eukaryotic expression, purification and monoclonal antibody preparation of a V protein of peste des petits ruminants. The methods include: establishing a prokaryotic expression vector pGEX-4T-V for a V gene of a peste des petits ruminant virus; identifying recombined pGEX-4T-V protein by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gelelectrophoresis) and western-blot; purifying the pGEX-4T-V protein and testing concentration; preparing the monoclonal antibody for a recombined pGEX-4T-V protein-immunized mice; preparing ascitic fluid of the monoclonal antibody; preparing the monoclonal antibody through polypeptide synthesis of a segment (a known sequence) of the V gene of the peste des petits ruminants; expressing the V protein of the peste des petits ruminants in eukaryotic expression; subjecting three monoclonal antibodies to indirect immunofluorescence, classification test and the like. The methods provide a reliable technical guarantee and support for diagnosis of the genetic engineering vaccine of the peste des petits ruminants.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for prokaryotic and eukaryotic expression and purification of Peste des petits ruminants V protein and preparation of monoclonal antibody. Background technique [0002] Peste des petits ruminants (PPR) is an acute, highly contagious infectious disease characterized by fever, stomatitis, diarrhea, and pneumonia caused by Peste des petits ruminants virus (PPRV) of the Paramyxoviridae family Measlesvirus, which has caused severe economic loss. OIE lists the disease as a severe infectious disease of category A, and my country lists it as a category Ⅰ animal disease. In July 2007, PPR broke out for the first time in Ali, Tibet, my country. The Chinese Ministry of Agriculture immediately announced the national technical specifications for the prevention and control of PPR, the emergency plan for the prevention and control of PPR, and implemented the PPR monitoring st...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/45C12N15/70C07K14/12C07K16/10
CPCC07K14/005C07K16/1027C12N15/70C12N2760/18422
Inventor 陆桂丽黄炯苗书魁马文戈王杰沙依兰·卡伊扎王延刘丽娅
Owner VETERINARY INST XINJINAG ACADEMY OF ANIMAL SCI CLINIC MEDICAL SCI RES CENT XINJIANG ACADEMY OF ANIMAL HUSBANDRY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com