Construction method of engineering bacteria producing beta-hydroxy-beta-methyl butyric acid

A technology of methylbutyric acid and engineering bacteria, which is applied in the construction field of Yarrowia lipolytica, can solve the problems of complex components of reaction products and difficulties in separation and purification

Active Publication Date: 2019-01-22
ZHEJIANG HUARUI BIOTECHNOLOGY CO LTD
View PDF13 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this method has problems such as complex components of the reaction product and difficulties in separation and purification in the later stage.
[0008] There is no report of producing HMB directly by fermentation of natural fungi or fungal engineered bacteria at present, which becomes the goal to be achieved by the present invention

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of engineering bacteria producing beta-hydroxy-beta-methyl butyric acid
  • Construction method of engineering bacteria producing beta-hydroxy-beta-methyl butyric acid
  • Construction method of engineering bacteria producing beta-hydroxy-beta-methyl butyric acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Example 1: Inactivation of five genes in the Yarrowia lipolytica genome

[0055] 1.1 Select the chassis cells as the target of metabolic pathway change

[0056] Yarrowia lipolytica ATCC MYA-2613 (purchased from the American Type Culture Collection (ATCC), USA) was used as the host bacteria, that is, the chassis cells. In order to alter its fatty acid degradation metabolic pathway (see figure 1 ), selected and constructed plasmids for targeted shearing of these five genes.

[0057] Use plasmid pCRISPRyl (purchased from Addgene), reference (Schwartz, C.M., M.S.Hussain, M.Blenner and I.Wheeldon. Synthetic RNA Polymerase III Promoters Facilitate High-Efficiency CRISPR–Cas9-Mediated Genome Editing in Yarrowialipolytica.ACS Synthetic Biology. 2016,5(4):356-359.), the following plasmids were constructed, as shown in Table 1.

[0058] Table 1

[0059] Plasmid name

target gene

sgRNA used

pCRISPRyl-pox2

YALI0F10857g

GCUGGAGUUCGGGCUGCUGU

...

Embodiment 2

[0080] Example 2: Integration of exogenous genes in Yarrowia lipolytica

[0081] 2.1 Design of expression cassettes for exogenous genes

[0082] LiuC, AibA and AibB genes derived from Myxococcus xanthus (also known as Myxococcus xanthus) and TesB genes derived from Escherichia coli were expressed in the gene spliced ​​strain obtained in Example 1. LiuC (uniprot: Q1D5Y4), AibA (uniprot: Q1D414), AibB (uniprot: Q1D413) and TesB (uniprot: P0AGG2) were synthesized after codon optimization by Suzhou Jinweizhi Biotechnology Co., Ltd. respectively. The promoters, genes and terminators to be used are shown in Table 3 below.

[0083] table 3

[0084] promoter number

promoter name

gene number

gene name

terminator number

terminator name

A

TEF1p

1

Liu C

α

Xpr2t

B

EXP1p

2

AibA

β

Mig1t

C

GPD

3

AibB

gamma

Lip2t

D

GPM1p

4

TesB

Ω

Lip1t

[0085] In the present i...

Embodiment 3

[0098] Embodiment 3: fermentation verification

[0099] Fermentation verification was carried out on the positive transformants identified and obtained in Example 2, and the transformants were respectively inoculated into YPD4 medium for fermentation. The highest HMB yield of positive transformants was 10g / L. On the contrary, in the host bacteria without gene knockout of fatty acid metabolism pathway, even if the above HMB biosynthesis pathway was integrated, no HMB product was found in positive transformants.

[0100] The above experimental results show that the Yarrowia lipolytica engineering bacteria constructed in the present invention can directly produce HMB through fermentation, and realize the effective accumulation of HMB in the fermentation broth. Those skilled in the art can easily understand that, compared with the chemical synthesis method, the biosynthesis method of the present invention has the natural advantage of being green and environment-friendly, and thus...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method of engineering bacteria producing beta-hydroxy-beta-methyl butyric acid, which includes the following steps: by taking yarrowia lipolytica as chassis cells, interrupting and inactivating five genes involved in fatty acid degradation and metabolism in the genome of yarrowia lipolytica, i.e. pox2, pox3, hbd, hcd and faa1, to obtain a gene-splicing strain; and integrating genes of LiuC, AibA and AibB from myxococcus xanthus, and a TesB gene from Escherichia coli into the genome of the gene-splitting strain to obtain the engineering bacteria producingbeta-hydroxy-beta-methyl butyric acid. The engineering bacteria constructed by the invention can ferment and synthesize the target product HMB with glucose as a carbon source, and the maximum yield can reach 10g / L.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and relates to a method for constructing a β-hydroxy-β-methylbutyric acid-producing engineering bacterium, in particular to a Yarrowia lipolytica used for producing β-hydroxy-β-methylbutyric acid Bacteria construction method. Background technique [0002] β-Hydroxy-β-methylbutyrate (3-Hydroxy-3-methylbutyrate Hydrate, HMB) is a colorless crystal with the molecular formula C 5 h 10 o 3 , the structural formula is: [0003] [0004] Calcium salt of HMB is a nutritional supplement, which can prevent muscle damage and muscle protein breakdown during endurance training of athletes, and can also be used as an active ingredient in weight loss food; it can promote animal growth, reduce fat, increase lean meat, and ensure animal health. This compound passed the GRAS certification of the United States in 1995, and the recommended dosage is ≤3g / day, with huge market potential. [0005] In the natu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/90C12N9/22C12N1/19C12P7/42C12R1/645
CPCC12N9/22C12N15/902C12P7/42
Inventor范文超高书良王金刚梁岩袁圣伦任亮
OwnerZHEJIANG HUARUI BIOTECHNOLOGY CO LTD