Unlock instant, AI-driven research and patent intelligence for your innovation.

Mulberry resveratrol synthase, coding gene thereof, recombinant vector and application thereof

A technology of resveratrol and recombinant vectors, which is applied in the field of cloning and yeast expression vector construction, and can solve the problems of no industrial application, no absolute dominant genes and related patents, and great differences in amino acid sequences

Inactive Publication Date: 2019-01-25
JIANGSU UNIV OF SCI & TECH
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since resveratrol synthase genes generally exist in the form of gene families in plants, the DNA and amino acid sequences of different resveratrol synthase genes are very different, and the different molecular weights of enzymes will produce different enzymatic characteristics and activities. There is a big difference, and there are no absolutely dominant genes and related patents, and there are no reports of industrial applications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mulberry resveratrol synthase, coding gene thereof, recombinant vector and application thereof
  • Mulberry resveratrol synthase, coding gene thereof, recombinant vector and application thereof
  • Mulberry resveratrol synthase, coding gene thereof, recombinant vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1 Mulberry mRNA extraction and the preparation of cDNA

[0036] 1) Take 100-200 mg of mulberry tissue and grind it into powder in liquid nitrogen, add 1 mL of Trizol solution, and pay attention that the leaves are always immersed in liquid nitrogen during the grinding process.

[0037] 2) The grinding solution was left at room temperature for 5 minutes, and chloroform was added to the grinding solution according to the volume ratio of Trizol solution and chloroform of 1:5, and vigorously shaken for 20 seconds.

[0038] 3) Static layering, take the upper aqueous phase into a new centrifuge tube, add an equal volume of isopropanol, let stand at room temperature for 10 minutes, and centrifuge at 10,000 rpm for 10 minutes.

[0039] 4) Discard the supernatant, add 70% ethanol according to the volume ratio of Trizol solution and 70% ethanol 1:1.5, vortex and mix well, and centrifuge at 10000rpm for 10min at 4°C.

[0040] 5) Discard the supernatant, dry at room tem...

Embodiment 2

[0043] Cloning of embodiment 2 mulberry MaRS gene

[0044] Design specific amplification upstream primers

[0045] MaRS-1: ATGGCDACMYCCTCCAWGAAA

[0046] and downstream primer MaRS-2: TTAATTAWTGRGAAGGCTTAC

[0047] Carry out PCR amplification resveratrol synthase gene with the cDNA of mulberry tree as template, PCR system and amplification condition are shown in Table 1, obtain the gene fragment of 1176bp ( figure 1), connect the resveratrol synthase gene fragment to the T cloning vector (refer to the Takara vector kit instruction manual) to obtain the ligation product, and then transform it into a competent E. coli DH5α strain, pick a positive clone and send it Sequencing was performed by Shanghai Sangon Biotechnology Co., Ltd., and the sequencing results were compared in NCBI.

[0048] Table 1 PCR system and conditions of mulberry resveratrol synthase gene

[0049]

[0050] PCR reaction program: 94°C, 5min

[0051]

Embodiment 3

[0052] Example 3 Construction process of yeast expression vector pESC-TRP-At4CL

[0053] Design specific amplification upstream primers

[0054] At4CL-1:CGGGATCCATGGCGCCACAAGAACAAGCAGT

[0055] and downstream primer At4CL-2: CCGCTCGAGTCACAATCCATTTGCTAGTTTTG

[0056] Arabidopsis thaliana 4CL gene (4-coumaric acid: Coenzyme A ligase, 4-coumarate: Co-enzyme A ligase; or 4-coumaryl- CoA ligase, 4-coumarate acyl-CoA ligase) (4CL gene can convert p-coumaric acid into one of the catalyzed substrates of resveratrol synthase—4-coumaryl-CoA, and the other substrate is The intracellular malonyl-CoA) PCR system and amplification conditions are shown in Table 2, and a 1686bp gene fragment (At4CL) was obtained, and the At4CL gene fragment was cut and recovered from the gel and connected to the pMD18-T cloning vector (refer to the Takara vector kit Instructions) to obtain the ligation product, and then transform it into a competent E. coli DH5α strain, and extract the plasmid pMD18-T-At4C...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a mulberry resveratrol synthetase, a coding gene, a recombinant vector and an application thereof. The amino acid sequence of resveratrol synthase from mulberry trees is shownin SEQ ID NO.1, and the gene sequence is shown in SEQ ID NO.1. The invention clones a resveratrol synthase gene (MaRS) of mulberry tree, which is a novel gene, and the gene length is 1176bp. This geneis the key gene of resveratrol biosynthesis in mulberry trees. The MaRS gene can be transformed into resveratrol using p-coumaric acid as substrate. Therefore, the gene can biosynthesize resveratrolby microbial fermentation, and has the development value in medicine, health food and cosmetics.

Description

technical field [0001] The invention relates to the construction of functional genes and yeast expression vectors, in particular to the cloning of a mulberry resveratrol synthase (MaRS) gene and the construction of yeast expression vectors. Background technique [0002] Resveratrol (Res) is a non-flavonoid natural polyphenolic substance with a stilbene structure that exists in a variety of plants. plant secondary metabolites. At present, resveratrol has been found in 72 species of plants belonging to 21 families and 31 genera, including Arachis, Cassia, Polygonum cuspidatum, Polygonum multiflorum, Pine and mulberry in the grape family and leguminous family. Studies have shown that resveratrol has many physiological and pharmacological effects such as anti-oxidation, anti-cancer, anti-bacterial, anti-inflammatory, cardiovascular protection, regulation of blood lipids and treatment of diabetes. [0003] Resveratrol synthase (Resveratrol Synthase, RS) is a key enzyme in the b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/52C12N9/00C12N15/63C12N15/82A01H5/00C12P7/22
CPCC12N9/00C12N15/8243C12P7/22
Inventor 曹喜涛季更生张业顺屠洁李强张国政
Owner JIANGSU UNIV OF SCI & TECH