Phyllostachys edulis PeTCP10 protein capable of controlling leaf curling, and applications thereof

A technology of moso bamboo and protein, applied in the field of plant molecular biology, can solve the problem that the function of TCP gene has not been reported yet

Active Publication Date: 2019-02-01
ANHUI AGRICULTURAL UNIVERSITY
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Most of the published genes regulating plant leaf development are TCP genes in model plants such

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Phyllostachys edulis PeTCP10 protein capable of controlling leaf curling, and applications thereof
  • Phyllostachys edulis PeTCP10 protein capable of controlling leaf curling, and applications thereof
  • Phyllostachys edulis PeTCP10 protein capable of controlling leaf curling, and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Sequence Analysis of Protein Encoded by PeTCP10 Gene of Phyllostachys pubescens

[0038] Use the bamboo database to find the PeTCP10 gene, and find the corresponding protein sequence (SEQ ID No.3), and according to the characteristics of the TCP gene, use DNAMAN software to compare the PeTCP protein sequence, find and mark the Non-basic Helix in the PeTCP protein sequence -Loop-Helix( figure 1 ) domain.

Embodiment 2

[0040] Cloning of PeTCP10 Protein Coding Sequence of Phyllostachys pubescens

[0041] 1. Extraction of TotalRNA from Phyllostachys pubescens leaves

[0042]Use 1mM gibberellin solution to treat healthy Phyllostachys pubescens seeds for 12 hours and then plant them in the medium (black soil: vermiculite=1:3), and in a greenhouse with a photoperiod (light / dark) of 18 / 6h and 25°C cultivated in. After growing for three months, select the moso bamboo seedlings with good growth conditions, get their leaves, and use the Trizol method to extract total RNA after freezing in liquid nitrogen. The specific method is as follows:

[0043] (1) Take 0.1g leaves on the ultra-clean workbench and put them into a sterilized mortar, add liquid nitrogen, quickly grind to powder, and put the powder into a 1.5mL RNAse Free Dof tube;

[0044] (2) Add 1mL Trizol to the tube, vibrate on the vortex for 20s to completely crack it, and let it stand for 5min;

[0045] (3) Then put it into a pre-cooled hi...

Embodiment 3

[0059] Cloning of PeTCP10 Protein Coding Sequence of Phyllostachys pubescens

[0060] According to the protein coding sequence of Phyllostachys edulis eTCP10, Primers 5.0 was used to design primers for PCR amplification of this fragment. The upstream primer added the GAATTC restriction site of EcoR I, and the downstream primer added the GGTACC restriction site of KpnI.

[0061] The primer sequences are as follows:

[0062] PeTCP10-F:5'-CGGAATTCATGGAGGCGCAGGTGC-3';

[0063] PeTCP10—R:5’—GGGGTACCCTACCGGTGGCCGA—3’

[0064] PCR was carried out using the totalRNA reverse transcription product of moso bamboo leaves as a template, and the reaction system is shown in Table 1:

[0065] Table 1 PCR reaction system

[0066]

[0067] The PCR reaction conditions were: pre-denaturation: 98°C 10min; denaturation: 98°C 10s; annealing: 62°C 5s; extension: 72°C 30s, 33 cycles; total extension: 72°C 10min.

[0068] After the reaction, draw the PCR product for 2% agarose gel electrophoresi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a Phyllostachys edulis PeTCP10 protein capable of controlling leaf curling, and applications thereof, wherein the amino acid sequence of the Phyllostachys edulis PeTCP10 protein is represented by SEQ ID No.3. The invention further provides a gene sequence encoding the Phyllostachys edulis PeTCP10 protein, wherein the deoxynucleotide sequence of the Phyllostachys edulis PeTCP10 protein is represented by SEQ ID No.2. The invention further relates to a vector containing the deoxynucleotide sequence of the gene. According to the present invention, a recombinant overexpression vector pCAMBIA1301-35S-PeTCP10 is transfected into wild-type Arabidopsis thaliana by using an Agrobacterium-mediated inflorescence impregnation method, and the results show that the leaf curling degree of the transgenic plant over-expressing PeTCP10 is significantly higher than the leaf curling degree of the wild type plant, such that the transgenic Arabidopsis thaliana can produce significantleaf curling through the Phyllostachys edulis PeTCP10 gene.

Description

technical field [0001] The invention relates to the field of plant molecular biology, in particular to a bamboo PeTCP10 protein with the function of controlling leaf curling and application thereof. Background technique [0002] Bamboo belongs to the Poaceae Bamboo subfamily. According to the meristematic reproduction characteristics and morphological characteristics of underground stems, it can be divided into three types: uniaxial scattered type, synaxial cluster type, and compound axis mixed type. Moso bamboo (Phyllostachys edulis) is a uniaxial scattered bamboo with fast growth, large biomass and wide cultivation area, and has high economic, cultural and ecological value. Moso bamboo is full of treasures, bamboo poles can be used as building materials, bamboo shoots can be used as food, and other parts can be made into handicrafts and other daily necessities. [0003] TCPs (TEOSINTE BRANCHED 1, CYCLOIDEA, and PROLIFERATING CELL FACTORS) are plant-specific transcription ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N15/66C12N1/21C12N15/11A01H5/12A01H6/20C12R1/01
CPCC07K14/415C12N15/66C12N15/8261
Inventor 项艳刘欢龙吴敏高亚蒙史亚男
Owner ANHUI AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap