Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Alpha-1, 2-fucosyltransferase and application thereof in milk powder

A technology of glycosyltransferase and fucosyl, applied in the field of bioengineering, can solve the problems of cumbersome operation, difficult separation and purification, and low yield of chemical synthesis methods, and achieve enhanced immunity, great commercial value, and high enzyme activity Effect

Inactive Publication Date: 2019-02-15
FUJIAN AGRI & FORESTRY UNIV
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Oligosaccharides can be obtained through separation and purification and / or in vitro synthesis, but because of their small content in the body, separation and purification are difficult, while chemical synthesis methods are cumbersome to operate, involve a large number of complex chemical reactions, and have low yields

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Alpha-1, 2-fucosyltransferase and application thereof in milk powder
  • Alpha-1, 2-fucosyltransferase and application thereof in milk powder
  • Alpha-1, 2-fucosyltransferase and application thereof in milk powder

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] (1) Based on the genomic DNA of Thermosynechococcus sp.NK55a (NCBI: NC_023033.1) provided by the NCBI database as a template, primers GATCCATATGTTCCAGCCGCTGCTGGAT and AAGGGATCCTTACTTCTTAACCAGT were designed and synthesized by Shanghai Sangon Bioengineering Company. Using the target gene as a template, PCR was used for gene amplification. The reaction system was: 5×rTaq PCR Buffer 10 μL; dNTP (2.5 mmol / L) 4 μL; upstream primer (20 mmol / L) 1 μL; downstream primer ( 20mmol / L) 1 μL; rTaq enzyme (2.5U / μL) 0.25 μL; DNA template 1 μL; make up to 50 μL with deionized water. PCR amplification conditions were: pre-denaturation at 94°C for 4 min, denaturation at 94°C for 45 s, annealing at 58°C for 30 s, extension at 72°C for 90 s, a total of 30 cycles, extension at 72°C for 10 min, and incubation at 4°C. The target gene fragment with a size of 891 bp ( figure 2 ).

[0026] Both the target gene and plasmid pET15b (purchased from Shanghai Sangong) were digested with two restrict...

Embodiment 2

[0031] Embodiment 2 Application in milk powder

[0032] A human milk oligosaccharide formula milk powder for infants and young children, the formula includes the following raw material components: α-1,2-fucosylated oligosaccharide 0.01-5%, skimmed milk powder 10-30%, desalted whey powder 20% -45%, lactose 15-30%, vegetable oil 10-30%, concentrated whey protein powder 2-10%, galacto-oligosaccharides 1-5%, fructo-oligosaccharides 1-5%, dietary fiber 0.1-6%, Mineral premix 0.8-1.5%, arachidonic acid 0.3-1.8%, docosahexaenoic acid 0.2-1.0%, vitamin premix 0.1-0.3%, casein phosphopeptide 0.10-0.22%, milk Ferritin 0.02-0.1%, L-tyrosine 0.02-0.09%, L-sodium ascorbate 0.03-0.12%, Nucleotide 0.018-0.05%, L-tryptophan 0.01-0.05%, L-methionine 0.01-0.05 %, taurine 0.01-0.04%, the sum of the above raw materials is 100%. Its preparation process specifically includes the following steps:

[0033] (1) Ingredients: α-1,2-fucosylated oligosaccharides, skimmed milk powder, desalted whey powd...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an alpha-1, 2-fucosyltransferase and an application thereof in a milk powder and belongs to the technical field of gene engineering. The invention relates to a nucleic acid andan amino acid sequence from thermophilic synechococcus (Thermosynechococcus sp. Nk 55a); the alpha-1, 2-fucosyltransferase is encoded; and obtained groups are separated to construct an expression vector pET15b-Tnfuct and converted into Escherichia coli strain BL21(DE3) to realize efficient expression. A method for generating fucosylated oligosaccharide, glycopeptide and glycoprotein by using the alpha-1, 2-fucosyltransferase has an application prospect in the industrial fields of infant milk powder, foods and medicines.

Description

technical field [0001] The invention relates to an alpha-1,2-fucosyltransferase and its application in milk powder, belonging to the technical field of bioengineering. Background technique [0002] Breast milk is the best food for newborns. It can not only provide the best nutrition for newborns, but also provide them with biologically active substances needed for growth and development. These natural active substances are beneficial for the colonization of the intestinal microbiota of newborns, the maturation of the immune system and systems, and the development of cognitive abilities. A large number of studies have found that human milk oligosaccharides (Human milkoligosaccharides, HMOS) is an important active factor in breast milk, which plays an extremely important role in the healthy growth of infants, can promote the proliferation of intestinal probiotics in infants, and resist pathogenic bacteria and virus invasion, as well as regulating the immune system. Neutral o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/10C12N15/54C12N15/70C12N1/21C12P19/04C12P19/12C12P19/00C12R1/19
Inventor 赵超李姗姗王莹刘丹钟汝婷袁思男
Owner FUJIAN AGRI & FORESTRY UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com