Alpha-1, 2-fucosyltransferase and application thereof in milk powder
A technology of glycosyltransferase and fucosyl, applied in the field of bioengineering, can solve the problems of cumbersome operation, difficult separation and purification, and low yield of chemical synthesis methods, and achieve enhanced immunity, great commercial value, and high enzyme activity Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] (1) Based on the genomic DNA of Thermosynechococcus sp.NK55a (NCBI: NC_023033.1) provided by the NCBI database as a template, primers GATCCATATGTTCCAGCCGCTGCTGGAT and AAGGGATCCTTACTTCTTAACCAGT were designed and synthesized by Shanghai Sangon Bioengineering Company. Using the target gene as a template, PCR was used for gene amplification. The reaction system was: 5×rTaq PCR Buffer 10 μL; dNTP (2.5 mmol / L) 4 μL; upstream primer (20 mmol / L) 1 μL; downstream primer ( 20mmol / L) 1 μL; rTaq enzyme (2.5U / μL) 0.25 μL; DNA template 1 μL; make up to 50 μL with deionized water. PCR amplification conditions were: pre-denaturation at 94°C for 4 min, denaturation at 94°C for 45 s, annealing at 58°C for 30 s, extension at 72°C for 90 s, a total of 30 cycles, extension at 72°C for 10 min, and incubation at 4°C. The target gene fragment with a size of 891 bp ( figure 2 ).
[0026] Both the target gene and plasmid pET15b (purchased from Shanghai Sangong) were digested with two restrict...
Embodiment 2
[0031] Embodiment 2 Application in milk powder
[0032] A human milk oligosaccharide formula milk powder for infants and young children, the formula includes the following raw material components: α-1,2-fucosylated oligosaccharide 0.01-5%, skimmed milk powder 10-30%, desalted whey powder 20% -45%, lactose 15-30%, vegetable oil 10-30%, concentrated whey protein powder 2-10%, galacto-oligosaccharides 1-5%, fructo-oligosaccharides 1-5%, dietary fiber 0.1-6%, Mineral premix 0.8-1.5%, arachidonic acid 0.3-1.8%, docosahexaenoic acid 0.2-1.0%, vitamin premix 0.1-0.3%, casein phosphopeptide 0.10-0.22%, milk Ferritin 0.02-0.1%, L-tyrosine 0.02-0.09%, L-sodium ascorbate 0.03-0.12%, Nucleotide 0.018-0.05%, L-tryptophan 0.01-0.05%, L-methionine 0.01-0.05 %, taurine 0.01-0.04%, the sum of the above raw materials is 100%. Its preparation process specifically includes the following steps:
[0033] (1) Ingredients: α-1,2-fucosylated oligosaccharides, skimmed milk powder, desalted whey powd...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



