Supercharge Your Innovation With Domain-Expert AI Agents!

Primer group, kit and method for detecting listeria monocytogenes on basis of intelligent isothermal amplification technology

A technology of Listeria monocytogenes and constant temperature amplification is applied in the field of primer sets for detecting Listeria monocytogenes, which can solve the problem of shortening the identification time of Listeria monocytogenes, reducing the difficulty and cost of identification technology, and the detection cycle. It can overcome the problems of gene polymorphism detection, accurate gene polymorphism and short detection time.

Inactive Publication Date: 2019-03-01
JINAN UNIVERSITY
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The current detection methods for common pathogenic bacteria in meat products are cumbersome, time-consuming, laborious, low sensitivity, poor specificity, and prone to false positives, which cannot meet the development needs of rapid identification of Listeria monocytogenes
With the development of molecular biology, many identification methods based on molecular biology techniques have emerged, such as PCR-SSCP, PCR-RFLP, DNA probes, DNA chips, DNA direct sequencing, etc., with their advantages of high efficiency and specificity It is favored, but requires high technical level of testing personnel, expensive equipment, and long testing cycle. In order to meet the needs of rapid identification and classification, it provides a fast and convenient method for scientific research, shortens the identification time of Listeria monocytogenes, and reduces the identification time. Technical difficulty and cost have always been hot spots in related research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group, kit and method for detecting listeria monocytogenes on basis of intelligent isothermal amplification technology
  • Primer group, kit and method for detecting listeria monocytogenes on basis of intelligent isothermal amplification technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Establishment of Listeria monocytogenes intelligent constant temperature amplification detection kit

[0035]Intelligent constant temperature amplification detection kit for Listeria monocytogenes, including intelligent constant temperature amplification primer set, intelligent constant temperature amplification reaction solution, Bst DNA polymerase, mismatch binding protein Tap Muts, positive control and negative control, fluorescence Reagent.

[0036] (1) Design of intelligent thermostatic amplification primers: The primers were designed with the hlyA gene of Listeria monocytogenes as the target gene. The primer sequences are listed in Table 1.

[0037] Table 1 Primer sequence list

[0038] Primer name

Primer sequence (5'-3')

FP

TTTATATATATATAAATCTCAGGTCATGTAGG (SEQ ID NO: 1)

TP

TAGGACTGAACAATTACGGCTTTGAAGGAA (SEQ ID NO: 2)

BP

ATATCATCAAAAAT (SEQ ID NO: 3)

OP1

GGCGTACGCGGGAAATCT (SEQ ID NO: 4)

...

Embodiment 2

[0042] Embodiment 2 establishes the Listeria monocytogenes detection method:

[0043] The method utilizing the kit of embodiment 1 to detect Listeria monocytogenes may further comprise the steps:

[0044] (1) Extraction of DNA from the sample to be tested: extract DNA from the sample using a bacterial DNA extraction kit;

[0045] (2) Isothermal gene amplification reaction: 25 μL reaction system contains 1.6 μmol / L of TP and EP primers, 0.8 μmol / L of BP primers, 0.5 μmol / L of OP1 and OP2 primers, 0.5 mmol / L of dNTPs, and 0.6 μmol / L of betaine mol / L, (NH4)2SO4mmol / L, MgCl2 2.5mmol / L, KCl 10mmol / L, MgSO42mmol / L, Green I 0.5μL, Tris-HCl with pH 8.8 20mmol / L, 0.2% 20. 6U Bst DNA polymerase, 1μg Tap Muts, 1μL DNA template, make up to 25μL with deionized water; set positive control and negative control; mix the prepared PCR tube and centrifuge, and react at 60-65℃ 40min.

[0046] (3) Judgment of results: place the reaction tube in the nucleic acid amplification instrument for r...

Embodiment 3

[0047] Embodiment 3 specificity experiment

[0048] Using the method of Example 2 to separate and purify Listeria monocytogenes ATCC19115 / 413, Salmonella ATCC14028, Staphylococcus aureus ATCC6538, Escherichia coli O157ATCC43889, Enterobacter sakazakii ATCC29544, Pseudomonas aeruginosa ATCC9027, Escherichia coli ATCC25922, Escherichia coli CMCC44102, Enterobacter sakazakii ATCC12868, Vibrio parahaemolyticus ATCC17802, Vibrio vulnificus ATCC27562, Staphylococcus aureus CMCC26003, Shigella baumannii CMCC51346, Shigella sonnei NICP51334, Proteus vulgaris NICPB490059, The DNA of Proteus mirabilis HB7131, Klebsiella CMCC (B) 46117, and Micrococcus luteus CMCC28001 were detected.

[0049] The identification results showed that the DNA of Listeria monocytogenes ATCC19115 / 413 was amplified normally, and the DNA of other bacteria and the negative control were not amplified (Table 2). showed good specificity.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer group, a kit and a method for detecting listeria monocytogenes on the basis of an intelligent isothermal amplification technology. The detecting primer group comprisesa TP primer, an FP primer, a BP primer, an OP1 primer and an OP2 primer. The detecting kit comprises a primer solution, a reaction solution, Bst DNA polymerase, mispairing binding protein, a color developing agent and controls. According to the detecting method, to-be-detected DNA is extracted, DNA polymerase activity with strand displacement activity is used, four specific primers and mispairingbinding protein are used, a sample DNA template is amplified at 60-65 DEG C, pg class of DNA can be detected, and the identification manner is performed as follows: SYBR(R) green I is added to a reaction system, whether amplification is performed is detected and judged by an ESE-tube scanner instrument, and whether the to-be-detected sample contains listeria monocytogenes DNA is determined. The method has the advantages of being rapid, efficient, convenient to operate, high in specificity, high in sensitivity, convenient in identification, suitable for field detection and the like and is suitable for promotion and application.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a primer set, a kit and a method for detecting Listeria monocytogenes based on an intelligent constant temperature amplification technology. Background technique [0002] Listeria monocytogenes (Listeria monocytogenes) is one of the key regulatory targets of the food safety department. It pollutes meat, milk, eggs, aquatic products and vegetables to varying degrees, and the pollution of meat and meat products is the most serious. Therefore, it is particularly important to establish a rapid, accurate, quantitative and reliable detection method for Listeria monocytogenes in meat. The current detection methods for common pathogenic bacteria in meat products are cumbersome, time-consuming, laborious, low sensitivity, poor specificity, and prone to false positives, which cannot meet the development needs of rapid identification of Listeria monocytogenes. With the development ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/689C12Q1/6844C12Q1/04C12N15/11C12R1/01
CPCC12Q1/6844C12Q1/689C12Q2563/107C12Q2549/125
Inventor 叶蕾石磊闫鹤陈洵常彦磊
Owner JINAN UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More