Acetohydroxyacid synthase mutant for improving L-valine synthesis efficiency

A technology of acetohydroxyacid synthase and mutants, which is applied in the field of metabolic engineering, can solve the problems of poor selectivity of the second substrate, etc., and achieve the effect of improving specificity and yield

Inactive Publication Date: 2019-04-05
JIANGNAN UNIV
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

AHAS is more specific for the first substrate pyruvate but less selective for the second substrate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Acetohydroxyacid synthase mutant for improving L-valine synthesis efficiency

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Embodiment 1: Construction of acetohydroxyacid synthase expression strain

[0025] Primers were designed according to the acetohydroxyacid synthase gene sequence of Corynebacterium glutamicum in NCBI, as follows

[0026] Upstream primer: CGC GGATCC AGAAGGAGGTATAGTAGTGAATGTGGCAGCTTCTCAACA

[0027] Downstream primer: G GAATTC TTAGATCTTGGCCGGAG

[0028] Link the PCR product of acetohydroxyacid synthase to the plasmid pJYW-4 (the construction method is disclosed in Construction of a novel expression system for use in Corynebacterium glutamicum), transform E.coliJM109 competent cells, and culture in 1 mL of LB medium For 40 minutes, take 50 μl of the bacterial solution and spread it on a solid LB plate containing kanamycin, incubate at 37°C for 10 hours, pick the positive colony, and culture it overnight on a shaker at 37°C, extract the plasmid, and verify that the enzyme digestion is correct. Lin company sequenced to obtain the construction of recombinant expression p...

Embodiment 2

[0030] Example 2: Obtaining of Mutants with Enhanced Substrate Specificity

[0031] Using site-directed mutagenesis, primers were designed as follows:

[0032] F: ATGCTTTCCAGGAAGTCGATATCCGCGGC

[0033] R: GCCGCGGATATCGACTTCCTGGAAAGCAT

[0034] Using the constructed plasmid pJYW4-ilvBN as a template, PCR was carried out to mutate the alanine at position 138 of acetohydroxyacid synthase into valine. The PCR conditions were 95°C for 5min, 34 cycles (95°C for 5min, 55°C for 30min, 68°C for 10min), 72°C for 10min, and 4°C for incubation. PCR amplification system: template 0.5 μl, upstream and downstream primers 0.5 μl, 5×PS Buffer 5 μl, dNTPmix 2 μl, primeSTAR 0.25 μl, ddH 2 O 16.25 μl. Take 5 μl for nucleic acid electrophoresis verification, add 1 μl DpnI to the rest to remove the template, and carry out transformation at 37°C for 1 hour. The transformant was sequenced by Tianlin Company, and the transformant was named pJYW4-ilvBN-A138V. By the electroporation method in Exam...

Embodiment 3

[0035] Example 3: High-specificity acetohydroxyacid synthase assay in glutamic acid rod-shaped rod enzyme activity

[0036] The strains sequenced correctly in Examples 1 and 2, and the starting strain ATCC 14067pJYW4 were respectively streaked on a solid LBB plate under the same conditions to activate the strains, cultured at 30°C for 48 hours, and the activated strains were divided into three mung bean-sized amounts, Transfer 50mL seed medium, culture at 30°C 200rpm for 12h, until the initial OD 562nm Transfer to 50mL fermentation medium at 1 o'clock, ferment at 30°C and 200rpm for 36h, take 3mL of fermentation broth to collect bacterial cells by centrifugation, and resuspend to OD with phosphate buffer 562nm If it is 7, the cells are sonicated for 20 minutes with an ultrasonic breaker, centrifuged at 12000 rpm for 15 minutes, and the supernatant is the acetohydroxyacid synthase enzyme solution. Using the enzyme activity detection method, when the pH is 5.8, the specific enzy...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an acetohydroxyacid synthase mutant for improving L-valine synthesis efficiency, which belongs to the field of metabolic engineering. Alanine with a relatively short side chainresidue near a second substrate binding site of acetohydroxyacid synthase is mutated into valine with a long side chain residue by virtue ofa site-specific mutagenesis method, the binding steric hindrance of the acetohydroxyacid synthase and the substrate is changed, the enzyme activity of the acetohydroxyacid synthase at low pH is improved, and the yield of L-valine is increased in the synthesisprocess of the L-valine. The modified enzyme is used to generate the L-valine, so that the production efficiency can be increased, and the heteroacid can be reduced.

Description

technical field [0001] The invention relates to an acetohydroxyacid synthase mutant capable of improving the synthesis efficiency of L-valine, which belongs to the field of metabolic engineering. Background technique [0002] Acetohydroxyacid synthase (Acetohydroxyacid synthase, AHAS) is the first key enzyme in the biosynthetic pathway of catalyzing branched-chain amino acids (L-valine, L-leucine, L-isoleucine). It is a Thiamindiphosphate (TPP)-dependent enzyme, which can catalyze the condensation of two molecules of pyruvate to form acetolactate with the assistance of TPP, metal ions and flavin adenine dinucleotide, namely The precursors of L-valine and L-leucine can catalyze a molecule of pyruvate and a molecule of 2-ketobutyrate to catalyze the formation of 2-acetyl-2-hydroxybutyrate, even if the metabolic pathway is towards the synthesis of L - Isoleucine. L-valine is one of the essential amino acids for the human body, and it is an important intermediate in the synthe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/88C12N15/60C12N15/77C12N1/21C12P13/08C12R1/15
CPCC12N9/88C12N15/77C12P13/08C12Y401/03
Inventor王小元柳亚迪胡晓清丁志祥朱丽飞
OwnerJIANGNAN UNIV