Supercharge Your Innovation With Domain-Expert AI Agents!

Novel marine organism pollution detection marker

A technology for marine organisms and marine pollution, applied in the determination/inspection of microorganisms, biochemical equipment and methods, plant genetic improvement, etc., to avoid the decline of amplification efficiency, improve accuracy and stability, and increase the success rate of reaction. Effect

Inactive Publication Date: 2019-04-12
ZHEJIANG OCEAN UNIV
View PDF7 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Tissues were subjected to LPS and Cu 2+ After the challenge, the relative expression of cytochrome P450 (cytochrome P450) in different tissues will change greatly, so it can be used to detect marine biological pollution. New marine bio-pollution detection markers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel marine organism pollution detection marker
  • Novel marine organism pollution detection marker
  • Novel marine organism pollution detection marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] 厚壳贻贝细胞色素P450酶CYP450,其基因的核苷酸序列为: ATGGTTGCGTTAACAGTTTACTTGGCAATAGCAGTGGCCTTGTGTGTAGCC GCTTACTTTAAATTCTTATTTAGGAAAAGAAGGGAAAATGAACCTCCTATTC CAACAGGACATTGGTTTTGGGGCAATGGTGAAGAATTTTCAAAGAACGCA GTTAAATTTCTACATTCTACGCAGAAAAAAATCGGAGATATATTCACTATTC GACTTTTCAATCAACACATGACCGTTATATTGGATCCTCATTCGTATGAAAA ATTTGTCAAAGAGAGAAATTTTGACTTTGATAAGATCCAAAAGCAAGTGAA CCACAATGTATTCAGTTTCGAGTTGGTGAATGCGCGTAAAATGTTGAAGGA AGCCGGAAAAACTGTGAGAGGACCATATCTTAACAAAGGAATGGCTCAAT TTTCGAACTATCTCAACGAAACATTCACGGAAGTTACTCAGTCTTCTACAG GTGAACACACAGATGAATGGAAAACAGCAGGACTTCGCTCATTCAACTCT CAAACATTATTCGCCTCACTGTTCTACACCATTTTCGGAAAAGGAGATGCG AGTGATGCAAGATTTAAACCATTGAGCGTTTACAAAAATTTCGATACTTTCCACAAGTATTTCAACTTTTTGTGGTTAGGCATGCCTGTTAAATTGTTTCCAAA GGCTGTGAAGGCATTAGAAGGGCTGTGTAATCAACCAACATCAGCAGAGT TGTTACAAAGAGACGATCTGTCCGAATACCTCCGATTTTCTACTAATTTCAT GTTAGAGCATAACCAAACAGAACAAGACATTATCGGACACAACTTGGTTTA TTTACACGTTAACTACAATACATTTCGACTGGCCTTCTGGAGCCTTTACAAA CTTTTGGAAAACAGAGAAGCACTAGAAGGATTACGAAAGGAAATTGACGA GGTGGTCCGATGTAAACGA...

Embodiment 2

[0096] The method for cloning cytochrome P450 mold CYP450 of mussel thick shell specifically comprises the following steps:

[0097] (1) Sample preparation:

[0098] 1) Thick-shelled mussels: the average weight of thick-shelled mussels is 61.5g, the average width of the shell under healthy conditions is 4.7cm, and the average shell height is 9.3cm. It comes from the Dongji Island Aquaculture Base (Zhoushan, Zhejiang, China), During the breeding period, filter seawater to maintain continuous oxygenation, and cultivate at a temperature of 24-25 ° C and a pH value of 8.0;

[0099] 2) DEPC water: add 500mL double-distilled water and 500μL DEPC to the blue-necked reagent bottle, and shake it overnight at 37°C for later use;

[0100] 3) DEPC-treated water: DEPC water was treated in an autoclave at 121°C for 30 minutes, and stored at 4°C after cooling for later use;

[0101] 4) 75% ethanol: Add 25 mL of DEPC-treated water to 75 mL of 100% ethanol, and store at -20°C for later use. ...

Embodiment 3

[0127] Based on the above-mentioned novel marine biological pollution detection marker of the mussel cytochrome P450 enzyme CYP450, the method of using the above-mentioned new marine biological pollution detection marker to detect marine biological pollution is: through the dissection, extraction and digestion of the mussel in the polluted area The RNA in the glands and gills is reverse-transcribed into DNA, and then the relative expression of cytochrome P450 enzyme CYP450 in the digestive glands and gills is detected by fluorescence quantitative technology. The specific steps of fluorescent quantitative technology detection are as follows: according to the obtained full-length cDNA sequence of cytochrome P450 enzyme CYP450 gene, the primers used for fluorescent quantitative analysis are designed as follows:

[0128] CYP450RT 01F: GTGCCATTAGTCCAGGGTG and

[0129] CYP450RT 01R: CCTGTACCATCACGAATGC, using β-actin gene as internal reference gene, where β-actin is:

[0130] actin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides cytochrome P450 enzyme CYP450. The nucleotide sequence of a gene of the cytochrome P450 enzyme CYP450 is SEQID NO.1, and the amino acid sequence of the cytochrome P450 enzyme CYP450 is SEQID NO.2. The invention also provides mytilus coruscus cytochrome P450 enzyme CYP450 as a novel marine organism pollution detection marker, and a method for detecting marine organism pollution. The novel marine organism pollution detection marker disclosed by the invention has the beneficial effects that the mytilus coruscus cytochrome P450 enzyme CYP450 is used as a marine pollution detection marker, is high in sensitivity and easy to detect and analyze, and can also be used for artificial breeding of mytilus coruscus, diseases and water quality deterioration can be discovered timely, generation of red tides can be prevented, and economic losses are reduced; and after the sea is polluted, the cytochrome P450 enzyme CYP450 has notable effects in the oxidation process, the contentof the cytochrome P450 enzyme CYP450 is notably increased, and through the changes, marine pollution can be effectively detected.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to cytochrome P450 enzyme CYP450, a novel marine biological pollution detection marker. Background technique [0002] Thick-shelled mussels (Mytilus coruscus) (Mollusca bivalves) are mainly distributed in Hokkaido, Japan in the Northwest Pacific Ocean, Jeju Island in the south of Korea, the Yellow Sea, the Bohai Sea, the East China Sea, and Taiwan, China. Mussels live by attaching to the appendages with silk, and use gills to filter food. Choose to eat tiny organisms and organic debris in seawater. Its breeding season is twice a year, and there are two breeding seasons in spring and autumn every year in Zhejiang sea area. Mussels are one of the fastest growing species in marine shellfish. In recent years, marine environmental pollution in China's waters has shown an intensifying trend. Furthermore, as a lower species, the thick-shelled mussel lacks an adapti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/02C12N15/53C12N15/10C12N15/70C12Q1/6888C12Q1/6851
CPCC12N9/0071C12N15/10C12N15/70C12Q1/6851C12Q1/6888C12Q2561/113C12Q2563/107C12Q2531/113
Inventor 郭宝英唐祖蓉叶莹莹刘硕博祁鹏志
Owner ZHEJIANG OCEAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More