Unlock instant, AI-driven research and patent intelligence for your innovation.

Heterologous expression purification method for recombination high temperature nickel and iron hydrogenase and application thereof

A nickel-iron hydrogenase and heterologous expression technology, which is applied in the field of expression and purification of nickel-iron hydrogenase and coenzyme regeneration, can solve the problems of regeneration that have not been studied yet, and achieve the effect of low production cost, high enzyme yield and simple steps

Active Publication Date: 2019-04-23
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The application of SHI in the regeneration of NADPH has been reported for a long time, but because its affinity for NAD is much lower than that of NADP, there is no research on its application in the regeneration of NADH.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Heterologous expression purification method for recombination high temperature nickel and iron hydrogenase and application thereof
  • Heterologous expression purification method for recombination high temperature nickel and iron hydrogenase and application thereof
  • Heterologous expression purification method for recombination high temperature nickel and iron hydrogenase and application thereof

Examples

Experimental program
Comparison scheme
Effect test

experiment example 1

[0062] Experimental example 1 T.kodakarensis shuttle vector construction

[0063] The present invention utilizes a shuttle vector to overexpress SHI in T. kodakarensis.

[0064] Using pTS543 as a template (plasmid derived from reference Santangelo TJ, Lu, Reeve JN. 2010. Thermococcus kodakarensis genetics: TK1827-encoded β-glycosidase, newpositive-selection protocol, and targeted and repetitive deletion technology. Appl. Environ. Microbiol. 76(4): 1044-52.), with primer 1 and primer 2 Amplify the target fragment, which contains all the sequences of the plasmid pTN1 autonomously replicating in T.kodakarensis and the genetic elements expressing the screening marker gene TK0149, the primer 1 sequence is:

[0065] GAAGCTCAGGTGGTACTTCACTCCACAATGGTTTCTTAGACGTCAGGTGGC, primer 2 sequence is:

[0066] GAATTTGCCAAATTGCCAGAATTGGCCATAGCTGTTTCCTGTGTGAAATTG; In addition, using pUC19 as a template, use primer 3 and primer 4 to amplify its origin of replication and the sequence of expressi...

experiment example 2

[0069] Experimental example 2 Construction of expression vector of recombinant high-temperature nickel-iron hydrogenase SHI

[0070] Access to Strong Promoter P via NCBI csg Sequence, referenced as (Kanai T, Simons JR, Tsukamoto R, Nakajima A, Omori Y, Matsuoka R, Beppu H, Imanaka T, Atomi H.2015.Overproduction of the membrane-bound[NiFe]-hydrogenase in Thermococcus kodakarensis and its effect on hydrogen production.Front.Microbiol.6:847.), design primer 5 and primer 6 (primer 5:

[0071] GAATTCTGCAGATATCCATCACACTGCGGCAAAAGGCGAATTATGTGTAG, Primer 6:

[0072] P csg Fragment; In addition, using pTE1 in Experimental Example 1 as a template, design primer 7

[0073] (CCCCAACAACCCAAGGAGGTGTTGTGCGGCCGCAAAAAAGTCGACTGCCG) and primer 8

[0074] (CTACACATAATTCGCCTTTTGCCGCAGTGTGATGGATATCTGCAGAATTC) amplified plasmid backbone; then by Simple Cloning (You, C., et al. (2012). "Simple Cloning via DirectTransformation of PCR Product (DNA Multimer) to Escherichia coli and Bacillus subtilis...

experiment example 3

[0085] Experimental Example 3 Detection of Hydrogenase Enzyme Activity

[0086] The hydrogenase detection method based on benzyl viologen BV used in the present invention is as follows: add 2ml reaction mixture (1mM BV, 100mM EPPS, pH 8.4) in 3ml sealed cuvette, fill in the anaerobic bottle containing 3% A mixed gas of hydrogen (nitrogen:hydrogen=97:3). After preheating the reaction solution and the enzyme sample at 85°C, add the enzyme to start the reaction. The reaction was carried out in a temperature-controllable 100CaryUV-Vis spectrophotometer (Agilent), the temperature was maintained at 85°C, and the change in absorbance at 578nm was detected in real time, that is, the amount of reduced BV produced. 1 U of enzyme activity is equivalent to oxidizing 1 μmol of hydrogen or reducing 2 μmol of BV in 1 min.

[0087] For the method of detecting hydrogenase with other electron carriers (NADP or methyl viologen MV, etc.), refer to the above detection method.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a heterologous expression purification method for a recombination high temperature nickel and iron hydrogenase and application thereof, and belongs to the field of expression purification and application of the nickel and iron hydrogenase. The disclosed high temperature nickel and iron hydrogenase is from pyrococcus furiosus, thermococcus kodakarensis at the other end of ashuttle vector is used for performing recombination over-expression, by means of combination and a histidine label and the specificity of a nickel column, the purifying process of the recombination hydrogenase is simplified, and the yield of the hydrogenase is increased; by coupling with diaphorase DI containing FMN, the novel electron transmission way is formed, and NADH regeneration is achievedby means of hydrogen. The expression purification method for the recombination high temperature nickel and iron hydrogenase has the advantages of being simplified in steps, high in enzyme yield, low in production cost and the like; in addition, according to the built coenzyme regeneration system, hydrogen (gas) is adopted as a substrate, the influence on a reaction system is small, the pH value ofthe solution cannot be changed, and products are easily separated.

Description

technical field [0001] The invention relates to a heterologous expression and purification method of recombinant high-temperature nickel-iron hydrogenase and its coenzyme regeneration application, belonging to the field of expression purification and coenzyme regeneration of nickel-iron hydrogenase. Background technique [0002] Hydrogenase catalyzes the reversible proton reduction hydrogen production reaction, and is a key enzyme in basic research related to biological hydrogen production and hydrogen energy batteries. Hydrogenases can be divided into single-iron hydrogenase (Fe Hase), double-iron hydrogenase (FeFe Hase) and nickel-iron hydrogenase (NiFe Hase) according to the different metal ions contained in their active centers. Fe Hase has only been found in some methane archaea. FeFe hydrogenase has a relatively high catalytic hydrogen production activity, but is highly sensitive to oxygen. Relatively speaking, NiFe hydrogenase is widely distributed and slightly less s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/74C12N9/02C12P7/56C12P19/36C12P19/32
CPCC12N9/0067C12N15/74C12P7/56C12P19/32C12P19/36
Inventor 张以恒宋云洪刘美霞
Owner TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI