Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation method of rhodioloside and kit

A technology of salidroside and sucrose phosphorylase, applied in the field of enzyme-catalyzed preparation of salidroside, which can solve the problems of complex catalyst preparation process, large amount of organic solvent, low conversion rate, etc., save production steps and reduce production costs , the effect of high yield

Active Publication Date: 2019-04-30
BEIJING TECHNOLOGY AND BUSINESS UNIVERSITY +1
View PDF6 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The main disadvantages of the above-mentioned biocatalytic method are the complex preparation process of the catalyst and the need for a large amount of organic solvent to achieve the condition of micro-aqueous phase.
In addition, most of them use β-glucosidase, which is a hydrolytic enzyme, and their hydrolysis is often greater than their synthesis, so the conversion rate is not high and the yield is low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of rhodioloside and kit
  • Preparation method of rhodioloside and kit
  • Preparation method of rhodioloside and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1. Preparation of recombinant heat-resistant sucrose phosphorylase and recombinant heat-resistant cellobiose phosphorylase

[0030] Unless otherwise specified, the methods used in the following examples are conventional methods, and all reagents used can be obtained from commercial sources.

[0031] A, the construction of sucrose phosphorylase Escherichia coli recombinant bacteria

[0032] The genome is extracted from Thermoanaerobacterium thermosaccharolyticum as a template, and PCR amplification is performed to obtain a PCR product. The PCR conditions were pre-denaturation at 94°C for 2 minutes; denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 1.5 minutes, 30 cycles; and incubation at 72°C for 10 minutes.

[0033] Upstream primer: CGC GGATCC ATGGCTCTGAAAAATAAAGTGCAACTG, the underline is the restriction site BamHI.

[0034] Downstream primer: CCG CTCGAG CACCAGGTATTTCACTTCTTCGCCGT, the restriction site XhoI is un...

Embodiment 2

[0045] Embodiment 2, synthetic salidroside

[0046] According to the concentration of sucrose 110g / L, tyrosol 42g / L and phosphoric acid 50mmol / L, 1.10g sucrose, 0.42g tyrosol and 57μL phosphoric acid (concentration 85%) were sequentially added to 6ml of citric acid buffer (50mmol / L, pH Value 7.0) in the reaction bottle (volume specification 25ml), stirring makes reaction raw material dissolve, then presses the concentration of 250U / L, adds the recombinant heat-resistant sucrose phosphatase enzyme liquid prepared in 0.5ml embodiment 1, presses 1200U / L again To a concentration of L, add 1 ml of the recombinant heat-resistant cellobiose phosphatase enzyme solution prepared in Example 1, and finally adjust the volume of the reaction solution to 10 ml with the same citric acid buffer solution, and adjust the pH of the reaction liquid to 7.0. Then place it in a constant temperature oscillator to carry out biological reaction to prepare salidroside. The reaction conditions are temper...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention discloses a preparation method of rhodioloside and a kit. The preparation method comprises following steps: mixing recombinant heatproof sucrose phosphorylase, recombinant heatproof cellobiose phosphorylase, cane sugar, tyrosol, and phosphoric acid to obtain a reaction mixture; then converting the reaction mixture at a temperature of 40 to 55 DEG C to generate rhodioloside. The preparation method has the advantages of simple technology, low cost, and high yield.

Description

technical field [0001] The invention relates to a method for preparing salidroside by enzymatic catalysis, and more specifically, the invention relates to a method and a kit for preparing salidroside by using sucrose phosphorylase and cellobiose phosphorylase to catalyze the preparation of salidroside. Background technique [0002] Salidroside is the main active ingredient of Rhodiola rosea. The content of salidroside in wild Rhodiola rosea plants is about 0.1% to 1.0%. Rhodiola is a precious traditional Chinese medicine and Tibetan medicine, which has various functions such as anti-fatigue, anti-hypoxia, anti-radiation, and improving human body functions. [0003] Conventionally, salidroside can be obtained through the following three methods: Rhodiola rosea extraction, chemical synthesis and biocatalysis. However, regarding the extraction of Rhodiola, firstly, Rhodiola belongs to plateau plants with limited resources, and the content of salidroside in Rhodiola is low, on...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12P19/44C12P19/18
CPCC12P19/18C12P19/44
Inventor 王洪钟董银卯黄爱清何聪芬张贵友
Owner BEIJING TECHNOLOGY AND BUSINESS UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com