Preparation method of rhodioloside and kit
A technology of salidroside and sucrose phosphorylase, applied in the field of enzyme-catalyzed preparation of salidroside, which can solve the problems of complex catalyst preparation process, large amount of organic solvent, low conversion rate, etc., save production steps and reduce production costs , the effect of high yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1. Preparation of recombinant heat-resistant sucrose phosphorylase and recombinant heat-resistant cellobiose phosphorylase
[0030] Unless otherwise specified, the methods used in the following examples are conventional methods, and all reagents used can be obtained from commercial sources.
[0031] A, the construction of sucrose phosphorylase Escherichia coli recombinant bacteria
[0032] The genome is extracted from Thermoanaerobacterium thermosaccharolyticum as a template, and PCR amplification is performed to obtain a PCR product. The PCR conditions were pre-denaturation at 94°C for 2 minutes; denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 1.5 minutes, 30 cycles; and incubation at 72°C for 10 minutes.
[0033] Upstream primer: CGC GGATCC ATGGCTCTGAAAAATAAAGTGCAACTG, the underline is the restriction site BamHI.
[0034] Downstream primer: CCG CTCGAG CACCAGGTATTTCACTTCTTCGCCGT, the restriction site XhoI is un...
Embodiment 2
[0045] Embodiment 2, synthetic salidroside
[0046] According to the concentration of sucrose 110g / L, tyrosol 42g / L and phosphoric acid 50mmol / L, 1.10g sucrose, 0.42g tyrosol and 57μL phosphoric acid (concentration 85%) were sequentially added to 6ml of citric acid buffer (50mmol / L, pH Value 7.0) in the reaction bottle (volume specification 25ml), stirring makes reaction raw material dissolve, then presses the concentration of 250U / L, adds the recombinant heat-resistant sucrose phosphatase enzyme liquid prepared in 0.5ml embodiment 1, presses 1200U / L again To a concentration of L, add 1 ml of the recombinant heat-resistant cellobiose phosphatase enzyme solution prepared in Example 1, and finally adjust the volume of the reaction solution to 10 ml with the same citric acid buffer solution, and adjust the pH of the reaction liquid to 7.0. Then place it in a constant temperature oscillator to carry out biological reaction to prepare salidroside. The reaction conditions are temper...
PUM
Property | Measurement | Unit |
---|---|---|
concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com