poshen1::osspl14 gene expression cassette and its construction method and application

A technology of gene expression cassette and construction method, which is applied in the field of construction and breeding application of pOsHEN1::OsSPL14 gene expression cassette, which can solve problems such as hindering gene application, decreased seed yield, decreased fertility, etc., and achieves broad application and market prospects, Effect of increasing yield and enhancing disease resistance

Active Publication Date: 2022-04-19
NANJING AGRICULTURAL UNIVERSITY
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These mutants often show cell death, high expression of disease resistance-related genes, and high accumulation of resistant substances, which can effectively inhibit the reproduction of bacteria or fungi. However, most of these mutants have dwarfed plants and reduced fertility in terms of growth and development. , decreased seed yield and other disadvantages
The study of these disease resistance genes has made a great contribution to the understanding of plant immune molecular pathways, but because of the above-mentioned developmental defects that often accompany it, it hinders the application of these genes in genetic breeding and production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • poshen1::osspl14 gene expression cassette and its construction method and application
  • poshen1::osspl14 gene expression cassette and its construction method and application
  • poshen1::osspl14 gene expression cassette and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Example 1 Constructing the pOsHEN1::OsSPL14 gene expression cassette and constructing a recombinant expression vector containing the pOsHEN1::OsSPL14 gene expression cassette

[0063] S1: Design cloning pOsHEN1-F primer about 2000bp upstream of the transcription start site of rice OsHEN1 gene, design pOsHEN1-R primer at the end of the 5' untranslated region of OsHEN1, use rice Nipponbare DNA as template, and OsHEN1 promoter-specific Primers pOsHEN1-F: tatgaccatgattacgaattcTTATGTGCACTAGAAACTATCTGAGGAC (SEQ ID No. 1) and pOsHen1-R: CAAACGCCCAAAAAAAACAA (SEQ ID No. 2) were used for PCR amplification, and the promoter amplification product of OsHen1 was cloned;

[0064] S2: Design primers for cloning OsSPL14-F based on the transcription start site of OsSPL14, and design primers for cloning OsSPL14-R about 500 bp downstream of the OsSPL14 transcription termination site, using rice Nipponbare DNA as a template, and OsSPL14 gene-specific primer OsSPL14-F: ttgttttttttgggcgtttgTT...

Embodiment 2

[0077] Example 2 Transformation of rice with the recombinant expression vector containing the pOsHen1::OsSPL14 gene expression cassette to obtain the transgenic line HS

[0078] The rice used for transformation is: wild-type rice Nipponbare (NIP).

[0079] The transformation method mediated by Agrobacterium oryzae was used to obtain multiple stable transgenic lines for the experimental research of the present invention. The specific transformation, infection and transgenic rice cultivation methods are as follows:

[0080] 1. Peel the mature rice seeds and select healthy and complete seeds.

[0081] 2. Wash and soak with 70% ethanol for 2-3 minutes, wash two to three times, and then wash with 10% sodium hypochlorite solution for 30 minutes.

[0082] 3. Wash with sterile water three to four times.

[0083] 4. Dry the peeled seeds on sterile filter paper.

[0084] 5. Place the dried seeds on the induction medium, and culture them in the dark for 15-20 days, until a large yellow...

Embodiment 3

[0092] Example 3 Study on Agronomic Traits of Transgenic Lines Without PXO99A Induction

[0093] In this study, the wild-type rice Nipponbare (NIP) was used as a control to study the agronomic traits of the four transgenic lines HS-2, HS-9, HS-8, and Hs-4 obtained in Example 2 without being induced by PXO99A.

[0094] 3.1 Plant background OsSPL14 expression level

[0095] Research method: Fluorescence quantitative PCR

[0096] 3.2 Trizol method to extract total RNA

[0097] Four transgenic lines HS-2, HS-9, HS-8, Hs-4 and NIP control were not induced by PXO99A, and the leaf samples were taken as follows:

[0098] (1) Weigh 0.1 g of fresh leaves, grind them quickly in liquid nitrogen with a mortar, and transfer them to a 1.5 mL centrifuge tube (pre-cooled with liquid nitrogen) after being thoroughly pulverized. And add 1mL Trizol to the centrifuge tube, place on ice for 10min;

[0099] (2) Add 100 uL of chloroform, shake vigorously for 30 seconds, and place on ice for 5 min...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a pOsHEN1::OsSPL14 gene expression cassette for balancing the opposite aspects of rice stress resistance and development, the pOsHEN1::OsSPL14 gene expression cassette includes an OsHEN1 promoter and an OsSPL14 gene, and the OsSPL14 gene is connected to the OsHEN1 promoter Downstream, the present invention also provides a recombinant expression vector containing the aforementioned pOsHEN1::OsSPL14 gene expression cassette, and a method for constructing the aforementioned recombinant expression vector. The gene expression cassette and recombinant expression vector of the present invention can produce excellent yield traits of rice such as increasing stem diameter and single tiller yield and / or improving resistance of rice to Xanthomonas oryzae PXO99A. When the transgenic lines are not invaded by PXO99A, the expression level of the background OsSPL14 in the transgenic rice is slightly increased, and the characteristics of OsSPL14 in regulating the ideal plant type of rice are exerted, and the tillering is appropriately reduced to increase the effective tiller number, increase the stem diameter and lodging resistance and improve Rice single tiller yield. When the transgenic line is invaded by PXO99A, the transcription level of the downstream OsSPL14 gene is greatly increased, which can specifically enhance the resistance to bacterial blight.

Description

technical field [0001] The invention relates to the technical field of plant genetic engineering, in particular to the construction and breeding application of the pOsHEN1::OsSPL14 gene expression cassette. Background technique [0002] Xanthomonas oryzae pv. oryzae, Xoo is the pathogen that causes rice bacterial blight. Bacterial blight of rice occurs in every rice area in my country and is the main disease of rice. At high temperature, the seedling lesion is short, small and narrow. After expanding, the leaves quickly wither and yellow, and there are many grains and broken rice. The yield reduction reaches 20%-30%, and the heavy one can reach 50%-60%. Harvesting has a greater impact on production. Therefore, it is extremely necessary to improve rice resistance to bacterial blight through genetic engineering. [0003] Plants, including crops, are mostly fixed in the growing place. They can change the signal network of endogenous growth and development according to the ev...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/29C12N15/82A01H5/00A01H6/46
Inventor杨东雷刘明明汪明璇张笑寒
OwnerNANJING AGRICULTURAL UNIVERSITY