Application of guided glycosyltransferase gene

A technology of glycosyltransferase and gene, applied in the field of gene function and application, can solve the problem of little research on the effect of culture condition transformation, and achieve the effect of improving screening efficiency

Inactive Publication Date: 2019-05-10
KUNMING UNIV OF SCI & TECH
View PDF12 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the EPS production of most lactic acid bacteria with excellent physiological activity cannot meet the needs of industrial production. Although optimization of the culture conditions can also be improved, the uncertainty of the culture conditions and the transformation effect involving experimental conditions and industrial fermentation methods There are very few studies on this aspect, so starting from the genetic level to study the functions of genes related to EPS synthesis and further understand its regulatory mechanism to understand the impact of related genes on EPS biosynthesis of lactic acid bacteria, combined with improving fermentation conditions, this method has stronger applications value

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of guided glycosyltransferase gene
  • Application of guided glycosyltransferase gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1: guide glycosyltransferase gene ( cps 2E, cps 4E) Knockout homology arm clones

[0032] 1. PCR amplification of upstream and downstream homology arms

[0033] The genome of food-borne Lactobacillus plantarum YM 4-3 was extracted using the TAKARA Bacterial Genomic DNA Extraction Kit (Bao Biological Engineering Co., Ltd.), and the specific operation was carried out according to the kit instructions. targeting genes cps2E , using the extracted genome as a template, and up-2EF (CCG GAATTC TGAACAGATCG ATACTGGTG, the underline is the restriction site Eco RI), up-2ER (ACATTTCTCATCTGGCGCGTTTGTGGTTGTACATGAC) and down-2EF (GTCATGTACAACCACAAAACGCGCCAGATGAGAAATGT), down-2ER (CCC TCGAG CATT TTTGCGACTCTCAT, the underline is the restriction site xho Ⅰ) Amplify to obtain the upstream and downstream homology arms cps2E-up (1066bp) and cps2E-down (1048bp). targeting genes cps4E , using the extracted genome as a template, and the primer pair up-4EF (CCG GAATTC...

Embodiment 2

[0040] Example 2: cps 2E, cps 4E Gene Single Knockout Vector Construction

[0041] restriction endonuclease Eco RI, xho I and Eco RI, Hin d Ⅲ Carry out synchronous digestion of the sequenced correct gene knockout fragment and the temperature-sensitive plasmid pFED760 respectively. cps The 2E enzyme digestion system is: Eco RI, 2 µL; xho Ⅰ, 2 µL; 1×Hbuffer, 4 µL; gene knockout fragment or pFED760, 10-16 µL; add sterilized deionized water to 20 µL. cps The 4E enzyme digestion system is: Eco RI, 1 µL; Hin d Ⅲ, 1 µL; 1×M buffer, 4 µL; gene knockout fragment or pFED760, 30 µL; add sterilized deionized water to 40 µL. After digestion at 37°C for 4 h, the digested products were recovered. After adding samples according to the target gene:vector = 4:1-2:1 (molar ratio), T4 DNA ligase was added and ligated at 16°C for 12-16 h; Transformation method: Introduce the ligation product into Escherichia coli DH5α competent cells, and then spread it on the erythromycin-LB s...

Embodiment 3

[0042] Example 3: cps 2E, cps 4E Gene Single Knockout Strain Construction

[0043] 1, cps 2E, cps 4E gene knockout vector introduced into Lactobacillus plantarum competent cells

[0044] Prepare Lactobacillus plantarum competent cells according to the method reported by Fei Yongtao (2015, master's degree thesis of South China University of Technology); add 10 μL gene knockout vectors pFED760-Δcps2E and pFED760-Δcps4E to 90~100 μL Lactobacillus plantarum competent, gently Mix evenly, and transfer to the pre-cooled electric shock cup after 5 minutes of ice bath, and conduct electric shock according to the parameters of 12.5kv / cm, 200Ω; after the electric shock is completed, quickly add 900 μL of fresh MRS culture solution to the electric shock cup, and gently blow and mix with the tip of the pipette. After homogenization, the mixture was transferred to a sterile 1.5mL centrifuge tube, and incubated at 28°C for 2.5-3 h to recover the cells. After cultivation, the bacterial s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a guided glycosyltransferase gene, namely application of the guided glycosyltransferase gene cps2E and cps4E in improving lactobacillus plantarum extracellular polysaccharide synthesis; the cps2E and cps4E genes and a temperature-sensitive plasmid pFED760 are recombined to construct a knockout vector, the knockout vector is guided into food-borne lactobacillus plantarum competent cells, and then by means of homologous recombination, cps2E and cps4E genes are constructed to knock out strains YM 4-3-deltacps2E, YM 4-3-deltacps4E and YM 4-3-deltacps2E-4E; the capacity of the strains producing extracellular polysaccharide is determined through a phenol-sulfuric acid method, it is found that the capacity of knocking out extracellular polysaccharide produced by the strains is lower than that of wild type strains, and the double knockout strain extracellular polysaccharide yield is very low, so that the cps2E and cps4E genes play a key role in the extracellular polysaccharide synthesis, and the application has great potential in extracellular polysaccharide biosynthesis research and application fields.

Description

technical field [0001] The invention belongs to the field of gene function and application, in particular to guiding glycosyltransferase gene cps 2E, cps Application of 4E in enhancing exopolysaccharide biosynthesis of Lactobacillus plantarum YM 4-3. Background technique [0002] Microbial exopolysaccharide (exopolysaccharide, EPS) is a type of carbohydrate compound that is secreted outside the cell and permeated in the medium during its biosynthetic metabolism. Compared with plant-derived and animal-derived polysaccharides, it has a shorter production cycle and less Restricted by seasons, pests, diseases and other conditions, it has strong market competitiveness and wide applicability. [0003] Lactic acid bacteria are known for their association with traditionally fermented foods and for their ability to impart unique flavor, texture, safety aspects to corresponding foods, and their growth characteristics make them unique in terms of food preservation. With the developm...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12N15/74C12P19/18C12P19/04C12R1/25
Inventor杨恩赵波柳陈坚罗义勇
OwnerKUNMING UNIV OF SCI & TECH